MIF4GD cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG14042-NF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MIF4GD Reagents
CRO Services
Product recommended

All MIF4GD Reagents
MIF4GD cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
771 bp
Description
Full length Clone DNA of Human MIF4G domain containing with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MIF4GD cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
AD023 cDNA ORF Clone, Human;MIFD cDNA ORF Clone, Human;SLIP1 cDNA ORF Clone, Human
MIF4GD Background Information
Full Name
MIF4G domain containing

MIF4GD cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MIF4GD cDNA ORF Clone in Cloning Vector, Mouse MG52027-G
MIF4GD cDNA ORF Clone, Mouse, untagged MG52027-UT
MIF4GD cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52027-ACG
MIF4GD Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52027-ACGLN
MIF4GD cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52027-ANG
MIF4GD cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52027-ACR
MIF4GD cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52027-ANR
MIF4GD cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52027-CF
MIF4GD cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52027-NF
MIF4GD cDNA ORF Clone, Mouse, C-His tag MG52027-CH
MIF4GD cDNA ORF Clone, Mouse, N-His tag MG52027-NH
MIF4GD cDNA ORF Clone, Mouse, C-HA tag MG52027-CY
MIF4GD cDNA ORF Clone, Mouse, N-HA tag MG52027-NY
MIF4GD cDNA ORF Clone, Mouse, C-Myc tag MG52027-CM
MIF4GD cDNA ORF Clone, Mouse, N-Myc tag MG52027-NM
MIF4GD qPCR Primer Pairs, Mouse MP201900

MIF4GD cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MIF4GD cDNA ORF Clone in Cloning Vector, Human HG14042-G
MIF4GD cDNA ORF Clone, Human, untagged HG14042-UT
MIF4GD Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14042-ACGLN
MIF4GD cDNA ORF Clone, Human, C-GFPSpark® tag HG14042-ACG
MIF4GD cDNA ORF Clone, Human, N-GFPSpark® tag HG14042-ANG
MIF4GD cDNA ORF Clone, Human, C-OFPSpark® tag HG14042-ACR
MIF4GD cDNA ORF Clone, Human, N-OFPSpark® tag HG14042-ANR
MIF4GD cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14042-CF
MIF4GD cDNA ORF Clone, Human, C-His tag HG14042-CH
MIF4GD cDNA ORF Clone, Human, N-His tag HG14042-NH
MIF4GD cDNA ORF Clone, Human, C-HA tag HG14042-CY
MIF4GD cDNA ORF Clone, Human, N-HA tag HG14042-NY
MIF4GD cDNA ORF Clone, Human, C-Myc tag HG14042-CM
MIF4GD cDNA ORF Clone, Human, N-Myc tag HG14042-NM
MIF4GD qPCR Primer Pairs, Human HP102698
info info
添加购物车成功! 添加购物车失败!