MIF cDNA ORF Clone, Human, N-His tag

Cat: HG10246-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MIF Reagents
CRO Services
Product recommended

All MIF Reagents
MIF cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
393 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human macrophage migration inhibitory factor (glycosylation-inhibiting factor) with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Restriction Sites
KpnI + XbaI(6kb+0.39kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
MIF cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MIF cDNA ORF Clone, Human, N-His tag Validated Images
Ferret TNF-alpha/TNFA/TNFSF2 Gene Plasmid Map 5629
MIF cDNA ORF Clone, Human, N-His tag Alternative Names
GIF cDNA ORF Clone, Human;GLIF cDNA ORF Clone, Human;MMIF cDNA ORF Clone, Human
MIF Background Information

Macrophage migration inhibitory factor (MIF) is an immunoregulatory cytokine, the effect of which on arresting random immune cell movement was recognized several decades ago. Despite its historic name, MIF also has a direct chemokine-like function and promotes cell recruitment. MIF is an ubiquitously expressed protein that plays a crucial role in many inflammatory and autoimmune disorders. Increasing evidence suggests that MIF also controls metabolic and inflammatory processes underlying the development of metabolic pathologies associated with obesity. Further research has shown that MIF plays a particularly critical part in cell cycle regulation and therefore in tumorigenesis as well. The significance of the role of MIF in a variety of both solid and hematologic tumors has been established. More recently, interest has increased in the role of MIF in the development of central nervous system (CNS) tumors, in which it appears to influence cell cycle control. MIF contributes to malignant disease progression on several different levels. Both circulating and intracellular MIF protein levels are elevated in cancer patients and MIF expression reportedly correlates with stage, metastatic spread and disease-free survival. Blockade of MIF bioactivity successfully inhibited tumor cell growth in vivo and in vitro. MIF plays important roles in the pathogenesis of gastrointestinal, hepatic, and pancreatic disorders.

Full Name
macrophage migration inhibitory factor (glycosylation-inhibiting factor)
References
  • Ohkawara T, et al. (2005) Pathophysiological roles of macrophage migration inhibitory factor in gastrointestinal, hepatic, and pancreatic disorders. J Gastroenterol. 40(2): 117-22.
  • Bach JP, et al.. (2009) The role of macrophage inhibitory factor in tumorigenesis and central nervous system tumors. Cancer. 115(10): 2031-40.
  • Rendon BE, et al.. (2009) Mechanisms of macrophage migration inhibitory factor (MIF)-dependent tumor microenvironmental adaptation. Exp Mol Pathol. 86(3): 180-5.
  • Grieb G, et al. (2010) Macrophage migration inhibitory factor (MIF): a promising biomarker. Drug News Perspect. 23(4): 257-64.
  • MIF cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    MIF cDNA ORF Clone in Cloning Vector, Mouse MG50066-M
    MIF cDNA ORF Clone, Mouse, untagged MG50066-UT
    MIF Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50066-ACGLN
    MIF cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50066-ACG
    MIF cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50066-ACR
    MIF cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50066-CF
    MIF cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50066-NF
    MIF cDNA ORF Clone, Mouse, C-His tag MG50066-CH
    MIF cDNA ORF Clone, Mouse, N-His tag MG50066-NH
    MIF cDNA ORF Clone, Mouse, C-HA tag MG50066-CY
    MIF cDNA ORF Clone, Mouse, N-HA tag MG50066-NY
    MIF cDNA ORF Clone, Mouse, C-Myc tag MG50066-CM
    MIF cDNA ORF Clone, Mouse, N-Myc tag MG50066-NM
    MIF qPCR Primer Pairs, Mouse MP200066

    MIF cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    MIF cDNA ORF Clone in Cloning Vector, Human HG10246-M
    MIF cDNA ORF Clone, Human, untagged HG10246-UT
    MIF Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10246-ACGLN
    MIF cDNA ORF Clone, Human, C-GFPSpark® tag HG10246-ACG
    MIF cDNA ORF Clone, Human, C-OFPSpark® tag HG10246-ACR
    MIF cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10246-CF
    MIF cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10246-NF
    MIF cDNA ORF Clone, Human, C-His tag HG10246-CH
    MIF cDNA ORF Clone, Human, C-HA tag HG10246-CY
    MIF cDNA ORF Clone, Human, N-HA tag HG10246-NY
    MIF cDNA ORF Clone, Human, C-Myc tag HG10246-CM
    MIF cDNA ORF Clone, Human, N-Myc tag HG10246-NM
    MIF qPCR Primer Pairs, Human HP100296
    info info
    添加购物车成功! 添加购物车失败!