CBARA1 cDNA ORF Clone, Human, C-HA tag

Cat: HG13567-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CBARA1 Reagents
CRO Services
Product recommended

All CBARA1 Reagents
CBARA1 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1473 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human calcium binding atopy-related autoantigen 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Restriction Sites
HindIII(two restriction sites) + XbaI(6kb+1.39kb+0.06kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
CBARA1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CBARA1 cDNA ORF Clone, Human, C-HA tag Validated Images
Human CBARA1 Gene Plasmid Map 17436
CBARA1 cDNA ORF Clone, Human, C-HA tag Alternative Names
CALC cDNA ORF Clone, Human;CBARA1 cDNA ORF Clone, Human;EFHA3 cDNA ORF Clone, Human;MPXPS cDNA ORF Clone, Human
CBARA1 Background Information
Full Name
mitochondrial calcium uptake 1

CBARA1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CBARA1 cDNA ORF Clone in Cloning Vector, Rat RG87873-U
CBARA1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG87873-ACGLN

CBARA1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CBARA1 cDNA ORF Clone in Cloning Vector, Mouse MG53033-G
CBARA1 cDNA ORF Clone, Mouse, untagged MG53033-UT
CBARA1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53033-ACGLN
CBARA1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53033-ACG
CBARA1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53033-ANG
CBARA1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53033-ACR
CBARA1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53033-ANR
CBARA1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53033-CF
CBARA1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53033-NF
CBARA1 cDNA ORF Clone, Mouse, C-His tag MG53033-CH
CBARA1 cDNA ORF Clone, Mouse, N-His tag MG53033-NH
CBARA1 cDNA ORF Clone, Mouse, C-HA tag MG53033-CY
CBARA1 cDNA ORF Clone, Mouse, N-HA tag MG53033-NY
CBARA1 cDNA ORF Clone, Mouse, C-Myc tag MG53033-CM
CBARA1 cDNA ORF Clone, Mouse, N-Myc tag MG53033-NM

CBARA1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CBARA1 cDNA ORF Clone in Cloning Vector, Human HG20983-U
CBARA1 cDNA ORF Clone in Cloning Vector, Human HG13567-G
CBARA1 cDNA ORF Clone, Human, untagged HG13567-UT
CBARA1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13567-ACG
CBARA1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13567-ACGLN
CBARA1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG20983-ACGLN
CBARA1 cDNA ORF Clone, Human, N-GFPSpark® tag HG13567-ANG
CBARA1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13567-ACR
CBARA1 cDNA ORF Clone, Human, N-OFPSpark® tag HG13567-ANR
CBARA1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13567-CF
CBARA1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13567-NF
CBARA1 cDNA ORF Clone, Human, C-His tag HG13567-CH
CBARA1 cDNA ORF Clone, Human, N-His tag HG13567-NH
CBARA1 cDNA ORF Clone, Human, N-HA tag HG13567-NY
CBARA1 cDNA ORF Clone, Human, C-Myc tag HG13567-CM
CBARA1 cDNA ORF Clone, Human, N-Myc tag HG13567-NM
CBARA1 qPCR Primer Pairs, Human HP102253
info info
添加购物车成功! 添加购物车失败!