Quick Order

Text Size:AAA

Human MGST1/Microsomal glutathione S-transferase 1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human MGST1 cDNA Clone Product Information
NCBI RefSeq:NM_020300.4
RefSeq ORF Size:468bp
cDNA Description:Full length Clone DNA of Homo sapiens microsomal glutathione S-transferase 1.
Gene Synonym:MGST, GST12, MGST-I
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human MGST1/Microsomal glutathione S-transferase 1 Gene ORF cDNA clone expression plasmid on other vectors
Human MGST1/Microsomal glutathione S-transferase 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG16248-ACG$225
Human MGST1/Microsomal glutathione S-transferase 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG16248-ACR$225
Human MGST1/Microsomal glutathione S-transferase 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG16248-ANG$225
Human MGST1/Microsomal glutathione S-transferase 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG16248-ANR$225
Human MGST1/Microsomal glutathione S-transferase 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG16248-CF$195
Human MGST1/Microsomal glutathione S-transferase 1 Gene ORF cDNA clone expression plasmid, C-His tagHG16248-CH$195
Human MGST1/Microsomal glutathione S-transferase 1 Gene ORF cDNA clone expression plasmid, C-Myc tagHG16248-CM$195
Human MGST1/Microsomal glutathione S-transferase 1 Gene ORF cDNA clone expression plasmid, C-HA tagHG16248-CY$195
Human MGST1/Microsomal glutathione S-transferase 1 Gene ORF cDNA clone in cloning vectorHG16248-G$75
Human MGST1/Microsomal glutathione S-transferase 1 Gene ORF cDNA clone expression plasmid, N-Flag tagHG16248-NF$195
Human MGST1/Microsomal glutathione S-transferase 1 Gene ORF cDNA clone expression plasmid, N-His tagHG16248-NH$195
Human MGST1/Microsomal glutathione S-transferase 1 Gene ORF cDNA clone expression plasmid, N-Myc tagHG16248-NM$195
Human MGST1/Microsomal glutathione S-transferase 1 Gene ORF cDNA clone expression plasmid, N-HA tagHG16248-NY$195
Human MGST1/Microsomal glutathione S-transferase 1 Gene ORF cDNA clone expression plasmidHG16248-UT$195
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: HG16248-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"