MGAT5 cDNA ORF Clone, Human, C-Myc tag

Cat: HG11373-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MGAT5 Reagents
CRO Services
Product recommended

All MGAT5 Reagents
MGAT5 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2271 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1425G/A not causing the amino acid variation.
Description
Full length Clone DNA of Human mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Restriction Sites
KpnI + XbaI(6kb+2.27kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
MGAT5 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MGAT5 cDNA ORF Clone, Human, C-Myc tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5611
MGAT5 cDNA ORF Clone, Human, C-Myc tag Alternative Names
GNT-V cDNA ORF Clone, Human;GNT-VA cDNA ORF Clone, Human
MGAT5 Background Information

Alpha-1,6-mannosylglycoprotein 6-beta-N-acetylglucosaminyltransferase A, also known as Alpha-mannoside beta-1,6-N-acetylglucosaminyl-transferase, Mannoside acetylglucosaminyltransferase 5, N-acetylglucosaminyl-transferase V, MGAT5 and GGNT5, is a single-pass type I I membrane protein which belongs to the glycosyltransferase 18 family. MGAT5 / GGNT5 catalyzes the addition of N-acetylglucosamine in beta 1-6 linkage to the alpha-linked mannose of biantennary N-linked oligosaccharides. It is one of the most important enzymes involved in the regulation of the biosynthesis of glycoprotein oligosaccharides. The central nervous system (CNS) is rich in glycoconjugates, located on cell surface and in extracellular matrix. MGAT5 / GGNT5 modification of complex-type N-glycans on CNS glycoproteins is involved in the regulation of depression-like behavior. Inhibitors of MGAT5 / GGNT5 might be useful in the treatment of malignancies by targeting their dependency on focal adhesion signaling for growth and metastasis.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
mannosyl (alpha-1,6-)-glycoprotein beta-1,6-N-acetyl-glucosaminyltransferase
References
  • Morgan,R. et al., 2004,J Immunol  173 (12): 7200-8.
  • Cheung,P. et al., 2007,Glycobiology  17 (7): 767-73.
  • Li,D. et al., 2008, J Immunol 180 (5): 3158-65.
  • Soleimani,L. et al., 2008, Genes Brain Behav. 7 (3):334-43.
  • info info
    添加购物车成功! 添加购物车失败!