MGAT2 cDNA ORF Clone, Human, N-Myc tag

Cat: HG14917-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MGAT2 Reagents
CRO Services
Product recommended

All MGAT2 Reagents
MGAT2 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1344 bp
Description
Full length Clone DNA of Human mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MGAT2 cDNA ORF Clone, Human, N-Myc tag Alternative Names
CDG2A cDNA ORF Clone, Human;CDGS2 cDNA ORF Clone, Human;GLCNACTII cDNA ORF Clone, Human;GNT-II cDNA ORF Clone, Human;GNT2 cDNA ORF Clone, Human
MGAT2 Background Information
Full Name
mannosyl (alpha-1,6-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase

MGAT2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MGAT2 cDNA ORF Clone in Cloning Vector, Rat RG84401-U
MGAT2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84401-ACGLN

MGAT2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MGAT2 cDNA ORF Clone in Cloning Vector, Mouse MG51598-G
MGAT2 cDNA ORF Clone, Mouse, untagged MG51598-UT
MGAT2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51598-ACGLN
MGAT2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51598-ACG
MGAT2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51598-ANG
MGAT2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51598-ACR
MGAT2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51598-ANR
MGAT2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51598-CF
MGAT2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51598-NF
MGAT2 cDNA ORF Clone, Mouse, C-His tag MG51598-CH
MGAT2 cDNA ORF Clone, Mouse, N-His tag MG51598-NH
MGAT2 cDNA ORF Clone, Mouse, C-HA tag MG51598-CY
MGAT2 cDNA ORF Clone, Mouse, N-HA tag MG51598-NY
MGAT2 cDNA ORF Clone, Mouse, C-Myc tag MG51598-CM
MGAT2 cDNA ORF Clone, Mouse, N-Myc tag MG51598-NM
MGAT2 qPCR Primer Pairs, Mouse MP201481

MGAT2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MGAT2 cDNA ORF Clone in Cloning Vector, Human HG14917-G
MGAT2 cDNA ORF Clone, Human, untagged HG14917-UT
MGAT2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14917-ACGLN
MGAT2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14917-ACG
MGAT2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14917-ACR
MGAT2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14917-CF
MGAT2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14917-NF
MGAT2 cDNA ORF Clone, Human, C-His tag HG14917-CH
MGAT2 cDNA ORF Clone, Human, N-His tag HG14917-NH
MGAT2 cDNA ORF Clone, Human, C-HA tag HG14917-CY
MGAT2 cDNA ORF Clone, Human, N-HA tag HG14917-NY
MGAT2 cDNA ORF Clone, Human, C-Myc tag HG14917-CM
MGAT2 qPCR Primer Pairs, Human HP103546
info info
添加购物车成功! 添加购物车失败!