MFAP4 cDNA ORF Clone, Human, C-HA tag

Cat: HG11195-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MFAP4 Reagents
CRO Services
Product recommended

All MFAP4 Reagents
MFAP4 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
768 bp
Description
Full length Clone DNA of Human microfibrillar-associated protein 4 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MFAP4 Background Information
Full Name
microfibrillar-associated protein 4

MFAP4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MFAP4 cDNA ORF Clone in Cloning Vector, Rat RG86507-U
MFAP4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG86507-ACGLN

MFAP4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MFAP4 cDNA ORF Clone in Cloning Vector, Mouse MG53909-U
MFAP4 cDNA ORF Clone, Mouse, untagged MG53909-UT
MFAP4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53909-ACG
MFAP4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53909-ACGLN
MFAP4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53909-ACR
MFAP4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53909-CF
MFAP4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53909-NF
MFAP4 cDNA ORF Clone, Mouse, C-His tag MG53909-CH
MFAP4 cDNA ORF Clone, Mouse, N-His tag MG53909-NH
MFAP4 cDNA ORF Clone, Mouse, C-HA tag MG53909-CY
MFAP4 cDNA ORF Clone, Mouse, N-HA tag MG53909-NY
MFAP4 cDNA ORF Clone, Mouse, C-Myc tag MG53909-CM
MFAP4 cDNA ORF Clone, Mouse, N-Myc tag MG53909-NM

MFAP4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MFAP4 cDNA ORF Clone in Cloning Vector, Human HG11195-M
MFAP4 cDNA ORF Clone, Human, untagged HG11195-UT
MFAP4 cDNA ORF Clone, Human, C-GFPSpark® tag HG11195-ACG
MFAP4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11195-ACGLN
MFAP4 cDNA ORF Clone, Human, C-OFPSpark® tag HG11195-ACR
MFAP4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11195-CF
MFAP4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11195-NF
MFAP4 cDNA ORF Clone, Human, C-His tag HG11195-CH
MFAP4 cDNA ORF Clone, Human, N-His tag HG11195-NH
MFAP4 cDNA ORF Clone, Human, N-HA tag HG11195-NY
MFAP4 cDNA ORF Clone, Human, C-Myc tag HG11195-CM
MFAP4 cDNA ORF Clone, Human, N-Myc tag HG11195-NM
MFAP4 qPCR Primer Pairs, Human HP101100
info info
添加购物车成功! 添加购物车失败!