METRNL/Meteorin‑like cDNA ORF Clone, Human, N-Myc tag

Cat: HG13136-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All METRNL/Meteorin‑like Reagents
CRO Services
Product recommended

All METRNL/Meteorin‑like Reagents
METRNL/Meteorin‑like cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
936 bp
Description
Full length Clone DNA of Human meteorin, glial cell differentiation regulator-like with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

METRNL/Meteorin‑like Background Information
Full Name
meteorin, glial cell differentiation regulator-like

METRNL/Meteorin‑like cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
METRNL/Meteorin‑like cDNA ORF Clone in Cloning Vector, Mouse MG51050-G
METRNL/Meteorin‑like cDNA ORF Clone, Mouse, untagged MG51050-UT
METRNL/Meteorin‑like Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51050-ACGLN
METRNL/Meteorin‑like cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51050-ACG
METRNL/Meteorin‑like cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51050-ACR
METRNL/Meteorin‑like cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51050-CF
METRNL/Meteorin‑like cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51050-NF
METRNL/Meteorin‑like cDNA ORF Clone, Mouse, C-His tag MG51050-CH
METRNL/Meteorin‑like cDNA ORF Clone, Mouse, N-His tag MG51050-NH
METRNL/Meteorin‑like cDNA ORF Clone, Mouse, C-HA tag MG51050-CY
METRNL/Meteorin‑like cDNA ORF Clone, Mouse, N-HA tag MG51050-NY
METRNL/Meteorin‑like cDNA ORF Clone, Mouse, C-Myc tag MG51050-CM
METRNL/Meteorin‑like cDNA ORF Clone, Mouse, N-Myc tag MG51050-NM
METRNL/Meteorin‑like qPCR Primer Pairs, Mouse MP201008

METRNL/Meteorin‑like cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
METRNL/Meteorin‑like cDNA ORF Clone in Cloning Vector, Human HG13136-G
METRNL/Meteorin‑like cDNA ORF Clone, Human, untagged HG13136-UT
METRNL/Meteorin‑like Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13136-ACGLN
METRNL/Meteorin‑like cDNA ORF Clone, Human, C-GFPSpark® tag HG13136-ACG
METRNL/Meteorin‑like cDNA ORF Clone, Human, C-OFPSpark® tag HG13136-ACR
METRNL/Meteorin‑like cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13136-CF
METRNL/Meteorin‑like cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13136-NF
METRNL/Meteorin‑like cDNA ORF Clone, Human, C-His tag HG13136-CH
METRNL/Meteorin‑like cDNA ORF Clone, Human, N-His tag HG13136-NH
METRNL/Meteorin‑like cDNA ORF Clone, Human, C-HA tag HG13136-CY
METRNL/Meteorin‑like cDNA ORF Clone, Human, N-HA tag HG13136-NY
METRNL/Meteorin‑like cDNA ORF Clone, Human, C-Myc tag HG13136-CM
METRNL/Meteorin‑like qPCR Primer Pairs, Human HP101755
info info
添加购物车成功! 添加购物车失败!