METAP1 cDNA ORF Clone, Human, N-Myc tag

Cat: HG10241-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All METAP1 Reagents
CRO Services
Product recommended

All METAP1 Reagents
METAP1 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1161 bp
Description
Full length Clone DNA of Human methionyl aminopeptidase 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

METAP1 cDNA ORF Clone, Human, N-Myc tag Alternative Names
MAP1A cDNA ORF Clone, Human;MetAP1A cDNA ORF Clone, Human
METAP1 Background Information

Processing of the N-terminal initiator methionine or formylated methionine is an essential cellular process conserved from prokaryotes to eukaryotes. The proteolytic removal of N-terminal methionine from nascent peptides is catalyzed by a family of enzymes known as methionine aminopeptidases (MetAPs) and is essential for cell growth. METAP1 and METAP2 have different substrate specificity due to the differences in both size and shape of the active sites. As a member of the M24 family of metalloproteases, METAP1 plays an important role in G(2)/M phase regulation of the cell cycle and may serve as a promising target for the discovery and development of new anticancer agents.

Full Name
methionyl aminopeptidase 1
References

1. Lowther, W.T. and B.W. Matthews, 2000, Biochim. Biophys. Acta. 1477: 157 – 167.

2. Addlaqatta, A. et al., 2005, Biochemistry. 44: 14741-14749.

3. Hu, X. et al., 2006, Proc. Natl. Acad. Sci. U.S.A. 103:18148-18153.

METAP1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
METAP1 cDNA ORF Clone in Cloning Vector, Rat RG8A3834-U
METAP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A3834-ACGLN

METAP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
METAP1 cDNA ORF Clone in Cloning Vector, Mouse MG50999-G
METAP1 cDNA ORF Clone, Mouse, untagged MG50999-UT
METAP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50999-ACGLN
METAP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50999-ACG
METAP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50999-ANG
METAP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50999-ACR
METAP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50999-ANR
METAP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50999-CF
METAP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50999-NF
METAP1 cDNA ORF Clone, Mouse, C-His tag MG50999-CH
METAP1 cDNA ORF Clone, Mouse, N-His tag MG50999-NH
METAP1 cDNA ORF Clone, Mouse, C-HA tag MG50999-CY
METAP1 cDNA ORF Clone, Mouse, N-HA tag MG50999-NY
METAP1 cDNA ORF Clone, Mouse, C-Myc tag MG50999-CM
METAP1 cDNA ORF Clone, Mouse, N-Myc tag MG50999-NM
METAP1 qPCR Primer Pairs, Mouse MP200964

METAP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
METAP1 cDNA ORF Clone in Cloning Vector, Human HG10241-G
METAP1 cDNA ORF Clone, Human, untagged HG10241-UT
METAP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10241-ACGLN
METAP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10241-ACG
METAP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG10241-ANG
METAP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10241-ACR
METAP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG10241-ANR
METAP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10241-CF
METAP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10241-NF
METAP1 cDNA ORF Clone, Human, C-His tag HG10241-CH
METAP1 cDNA ORF Clone, Human, N-His tag HG10241-NH
METAP1 cDNA ORF Clone, Human, C-HA tag HG10241-CY
METAP1 cDNA ORF Clone, Human, N-HA tag HG10241-NY
METAP1 cDNA ORF Clone, Human, C-Myc tag HG10241-CM
METAP1 qPCR Primer Pairs, Human HP100291
info info
添加购物车成功! 添加购物车失败!