Meprin beta cDNA ORF Clone, Human, C-Myc tag

Cat: HG10708-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Meprin beta Reagents
CRO Services
Product recommended

All Meprin beta Reagents
Meprin beta cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2106 bp
Description
Full length Clone DNA of Human meprin A, beta with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Meprin beta Background Information
Full Name
meprin A, beta

Meprin beta cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Meprin beta cDNA ORF Clone in Cloning Vector, Mouse MG59089-U
Meprin beta cDNA ORF Clone, Mouse, untagged MG59089-UT
Meprin beta Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59089-ACGLN
Meprin beta cDNA ORF Clone, Mouse, C-GFPSpark® tag MG59089-ACG
Meprin beta cDNA ORF Clone, Mouse, C-OFPSpark® tag MG59089-ACR
Meprin beta cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG59089-CF
Meprin beta cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG59089-NF
Meprin beta cDNA ORF Clone, Mouse, C-His tag MG59089-CH
Meprin beta cDNA ORF Clone, Mouse, N-His tag MG59089-NH
Meprin beta cDNA ORF Clone, Mouse, C-HA tag MG59089-CY
Meprin beta cDNA ORF Clone, Mouse, N-HA tag MG59089-NY
Meprin beta cDNA ORF Clone, Mouse, C-Myc tag MG59089-CM
Meprin beta cDNA ORF Clone, Mouse, N-Myc tag MG59089-NM

Meprin beta cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Meprin beta cDNA ORF Clone in Cloning Vector, Human HG10708-G
Meprin beta cDNA ORF Clone, Human, untagged HG10708-UT
Meprin beta Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10708-ACGLN
Meprin beta cDNA ORF Clone, Human, C-GFPSpark® tag HG10708-ACG
Meprin beta cDNA ORF Clone, Human, C-OFPSpark® tag HG10708-ACR
Meprin beta cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10708-CF
Meprin beta cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10708-NF
Meprin beta cDNA ORF Clone, Human, C-His tag HG10708-CH
Meprin beta cDNA ORF Clone, Human, N-His tag HG10708-NH
Meprin beta cDNA ORF Clone, Human, C-HA tag HG10708-CY
Meprin beta cDNA ORF Clone, Human, N-HA tag HG10708-NY
Meprin beta cDNA ORF Clone, Human, N-Myc tag HG10708-NM
Meprin beta qPCR Primer Pairs, Human HP100884
info info
添加购物车成功! 添加购物车失败!