Quick Order

Human MEK1/MAP2K1/MKK1 Gene ORF cDNA clone expression plasmid, C-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Human MAP2K1 cDNA Clone Product Information
    NCBI RefSeq:NM_002755.3
    RefSeq ORF Size:1182bp
    cDNA Description:Full length Clone DNA of Homo sapiens mitogen-activated protein kinase kinase 1 with C terminal HA tag.
    Gene Synonym:MEK1, MKK1, MAPKK1, PRKMK1, MAP2K1
    Species:Human
    Vector:pCMV3-C-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with MAP2K1 qPCR primers for gene expression analysis, HP100873 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Background

    MEK1, also known as MAP2K1 and MKK1, is a member of the dual specificity protein kinase family, which acts as a mitogen-activated protein (MAP) kinase kinase. MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals. MEK1 is widely expressed, with extremely low levels in brain. It lies upstream of MAP kinases and stimulates the enzymatic activity of MAP kinases upon wide variety of extra- and intracellular signals. As an essential component of MAP kinase signal transduction pathway, MEK1 is involved in many cellular processes such as proliferation, differentiation, transcription regulation and development. Binding extracellular ligands such as growth factors, cytokines and hormones to their cell-surface receptors activates RAS and this initiates RAF1 activation. RAF1 then further activates the dual-specificity protein kinases MAP2K1 and MEK2. MEK1 has been shown to export PPARG from the nucleus. The MAPK cascade is also involved in the regulation of endosomal dynamics, including lysosome processing and endosome cycling through the perinuclear recycling compartment (PNRC), as well as in the fragmentation of the Golgi apparatus during mitosis. MKK1 catalyzes the concomitant phosphorylation of a threonine and a tyrosine residue in a Thr-Glu-Tyr sequence located in MAP kinases. Defects in MEK1 can cause cardiofaciocutaneous syndrome.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    References
  • Rampoldi L, et al. (1998) Chromosomal localization of four MAPK signaling cascade genes: MEK1, MEK3, MEK4 and MEKK5. Cytogenet Cell Genet. 78(3-4):301-3.
  • Zheng CF, et al. (1993) Cloning and characterization of two distinct human extracellular signal-regulated kinase activator kinases, MEK1 and MEK2. J Biol Chem. 268(15):11435-9.
  • Nantel, et al. (1998) Interaction of the Grb10 adapter protein with the Raf1 and MEK1 kinases. J Biol Chem. 273(17):10475-84.
  • Hirata H, et al. (2012) I MicroRNA-1826 targets VEGFC, beta-catenin (CTNNB1) and MEK1 (MAP2K1) in human bladder cancer. Carcinogenesis. 33(1):41-8.
  • Size / Price
    Catalog: HG10661-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"