MED21/Surb7 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG14515-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MED21/Surb7 Reagents
CRO Services
Product recommended

All MED21/Surb7 Reagents
MED21/Surb7 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
435 bp
Description
Full length Clone DNA of Human mediator complex subunit 21 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MED21/Surb7 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
hSrb7 cDNA ORF Clone, Human;SRB7 cDNA ORF Clone, Human;SURB7 cDNA ORF Clone, Human
MED21/Surb7 Background Information
Full Name
mediator complex subunit 21

MED21/Surb7 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MED21/Surb7 cDNA ORF Clone in Cloning Vector, Mouse MG53285-U
MED21/Surb7 cDNA ORF Clone, Mouse, untagged MG53285-UT
MED21/Surb7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53285-ACGLN
MED21/Surb7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53285-ACG
MED21/Surb7 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53285-ANG
MED21/Surb7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53285-ACR
MED21/Surb7 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53285-ANR
MED21/Surb7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53285-CF
MED21/Surb7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53285-NF
MED21/Surb7 cDNA ORF Clone, Mouse, C-His tag MG53285-CH
MED21/Surb7 cDNA ORF Clone, Mouse, N-His tag MG53285-NH
MED21/Surb7 cDNA ORF Clone, Mouse, C-HA tag MG53285-CY
MED21/Surb7 cDNA ORF Clone, Mouse, N-HA tag MG53285-NY
MED21/Surb7 cDNA ORF Clone, Mouse, C-Myc tag MG53285-CM
MED21/Surb7 cDNA ORF Clone, Mouse, N-Myc tag MG53285-NM

MED21/Surb7 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MED21/Surb7 cDNA ORF Clone in Cloning Vector, Human HG14515-G
MED21/Surb7 cDNA ORF Clone, Human, untagged HG14515-UT
MED21/Surb7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14515-ACGLN
MED21/Surb7 cDNA ORF Clone, Human, C-GFPSpark® tag HG14515-ACG
MED21/Surb7 cDNA ORF Clone, Human, N-GFPSpark® tag HG14515-ANG
MED21/Surb7 cDNA ORF Clone, Human, C-OFPSpark® tag HG14515-ACR
MED21/Surb7 cDNA ORF Clone, Human, N-OFPSpark® tag HG14515-ANR
MED21/Surb7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14515-NF
MED21/Surb7 cDNA ORF Clone, Human, C-His tag HG14515-CH
MED21/Surb7 cDNA ORF Clone, Human, N-His tag HG14515-NH
MED21/Surb7 cDNA ORF Clone, Human, C-HA tag HG14515-CY
MED21/Surb7 cDNA ORF Clone, Human, N-HA tag HG14515-NY
MED21/Surb7 cDNA ORF Clone, Human, C-Myc tag HG14515-CM
MED21/Surb7 cDNA ORF Clone, Human, N-Myc tag HG14515-NM
MED21/Surb7 qPCR Primer Pairs, Human HP103162
info info
添加购物车成功! 添加购物车失败!