MED20 cDNA ORF Clone, Human, N-His tag

Cat: HG15449-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MED20 Reagents
CRO Services
Product recommended

All MED20 Reagents
MED20 cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
639 bp
Description
Full length Clone DNA of Human mediator complex subunit 20 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MED20 cDNA ORF Clone, Human, N-His tag Alternative Names
PRO0213 cDNA ORF Clone, Human;TRFP cDNA ORF Clone, Human
MED20 Background Information
Full Name
mediator complex subunit 20

MED20 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MED20 cDNA ORF Clone in Cloning Vector, Rat RG81190-U
MED20 cDNA ORF Clone, Rat, untagged RG81190-UT
MED20 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81190-ACGLN
MED20 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81190-ACG
MED20 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81190-ANG
MED20 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81190-ACR
MED20 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81190-ANR
MED20 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81190-CF
MED20 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81190-NF
MED20 cDNA ORF Clone, Rat, C-His tag RG81190-CH
MED20 cDNA ORF Clone, Rat, N-His tag RG81190-NH
MED20 cDNA ORF Clone, Rat, C-HA tag RG81190-CY
MED20 cDNA ORF Clone, Rat, N-HA tag RG81190-NY
MED20 cDNA ORF Clone, Rat, C-Myc tag RG81190-CM
MED20 cDNA ORF Clone, Rat, N-Myc tag RG81190-NM
MED20 qPCR Primer Pairs, Rat RP301146

MED20 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MED20 cDNA ORF Clone in Cloning Vector, Mouse MG53237-G
MED20 cDNA ORF Clone, Mouse, untagged MG53237-UT
MED20 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53237-ACGLN
MED20 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53237-ACG
MED20 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53237-ANG
MED20 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53237-ACR
MED20 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53237-ANR
MED20 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53237-CF
MED20 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53237-NF
MED20 cDNA ORF Clone, Mouse, C-His tag MG53237-CH
MED20 cDNA ORF Clone, Mouse, N-His tag MG53237-NH
MED20 cDNA ORF Clone, Mouse, C-HA tag MG53237-CY
MED20 cDNA ORF Clone, Mouse, N-HA tag MG53237-NY
MED20 cDNA ORF Clone, Mouse, C-Myc tag MG53237-CM
MED20 cDNA ORF Clone, Mouse, N-Myc tag MG53237-NM

MED20 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MED20 cDNA ORF Clone in Cloning Vector, Human HG15449-G
MED20 cDNA ORF Clone, Human, untagged HG15449-UT
MED20 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15449-ACGLN
MED20 cDNA ORF Clone, Human, C-GFPSpark® tag HG15449-ACG
MED20 cDNA ORF Clone, Human, N-GFPSpark® tag HG15449-ANG
MED20 cDNA ORF Clone, Human, C-OFPSpark® tag HG15449-ACR
MED20 cDNA ORF Clone, Human, N-OFPSpark® tag HG15449-ANR
MED20 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15449-CF
MED20 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15449-NF
MED20 cDNA ORF Clone, Human, C-His tag HG15449-CH
MED20 cDNA ORF Clone, Human, C-HA tag HG15449-CY
MED20 cDNA ORF Clone, Human, N-HA tag HG15449-NY
MED20 cDNA ORF Clone, Human, C-Myc tag HG15449-CM
MED20 cDNA ORF Clone, Human, N-Myc tag HG15449-NM
MED20 qPCR Primer Pairs, Human HP104073
info info
添加购物车成功! 添加购物车失败!