MED19 cDNA ORF Clone, Human, untagged

Cat: HG15498-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MED19 Reagents
CRO Services
Product recommended

All MED19 Reagents
MED19 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
585 bp
Description
Full length Clone DNA of Human mediator complex subunit 19.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MED19 cDNA ORF Clone, Human, untagged Alternative Names
DT2P1G7 cDNA ORF Clone, Human;LCMR1 cDNA ORF Clone, Human
MED19 Background Information
Full Name
mediator complex subunit 19

MED19 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MED19 cDNA ORF Clone in Cloning Vector, Mouse MG5A5125-U
MED19 cDNA ORF Clone, Mouse, untagged MG5A5125-UT
MED19 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5125-ACGLN
MED19 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5125-ACG
MED19 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A5125-ANG
MED19 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A5125-ACR
MED19 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A5125-ANR
MED19 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A5125-CF
MED19 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A5125-NF
MED19 cDNA ORF Clone, Mouse, C-His tag MG5A5125-CH
MED19 cDNA ORF Clone, Mouse, N-His tag MG5A5125-NH
MED19 cDNA ORF Clone, Mouse, C-HA tag MG5A5125-CY
MED19 cDNA ORF Clone, Mouse, N-HA tag MG5A5125-NY
MED19 cDNA ORF Clone, Mouse, C-Myc tag MG5A5125-CM
MED19 cDNA ORF Clone, Mouse, N-Myc tag MG5A5125-NM

MED19 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MED19 cDNA ORF Clone in Cloning Vector, Human HG15498-G
MED19 cDNA ORF Clone, Human, C-GFPSpark® tag HG15498-ACG
MED19 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15498-ACGLN
MED19 cDNA ORF Clone, Human, N-GFPSpark® tag HG15498-ANG
MED19 cDNA ORF Clone, Human, C-OFPSpark® tag HG15498-ACR
MED19 cDNA ORF Clone, Human, N-OFPSpark® tag HG15498-ANR
MED19 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15498-CF
MED19 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15498-NF
MED19 cDNA ORF Clone, Human, C-His tag HG15498-CH
MED19 cDNA ORF Clone, Human, N-His tag HG15498-NH
MED19 cDNA ORF Clone, Human, C-HA tag HG15498-CY
MED19 cDNA ORF Clone, Human, N-HA tag HG15498-NY
MED19 cDNA ORF Clone, Human, C-Myc tag HG15498-CM
MED19 cDNA ORF Clone, Human, N-Myc tag HG15498-NM
MED19 qPCR Primer Pairs, Human HP104120
info info
添加购物车成功! 添加购物车失败!