MEAF6/C1orf149 cDNA ORF Clone, Human, untagged

Cat: HG16222-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MEAF6/C1orf149 Reagents
CRO Services
Product recommended

All MEAF6/C1orf149 Reagents
MEAF6/C1orf149 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
576 bp
Description
Full length Clone DNA of Human MYST/Esa1-associated factor 6.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MEAF6/C1orf149 cDNA ORF Clone, Human, untagged Alternative Names
C1orf149 cDNA ORF Clone, Human;CENP-28 cDNA ORF Clone, Human;EAF6 cDNA ORF Clone, Human;NY-SAR-91 cDNA ORF Clone, Human
MEAF6/C1orf149 Background Information
Full Name
MYST/Esa1-associated factor 6

MEAF6/C1orf149 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MEAF6/C1orf149 cDNA ORF Clone in Cloning Vector, Rat RG81694-G
MEAF6/C1orf149 cDNA ORF Clone, Rat, untagged RG81694-UT
MEAF6/C1orf149 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81694-ACG
MEAF6/C1orf149 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81694-ACGLN
MEAF6/C1orf149 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81694-ANG
MEAF6/C1orf149 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81694-ACR
MEAF6/C1orf149 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81694-ANR
MEAF6/C1orf149 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81694-CF
MEAF6/C1orf149 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81694-NF
MEAF6/C1orf149 cDNA ORF Clone, Rat, C-His tag RG81694-CH
MEAF6/C1orf149 cDNA ORF Clone, Rat, N-His tag RG81694-NH
MEAF6/C1orf149 cDNA ORF Clone, Rat, C-HA tag RG81694-CY
MEAF6/C1orf149 cDNA ORF Clone, Rat, N-HA tag RG81694-NY
MEAF6/C1orf149 cDNA ORF Clone, Rat, C-Myc tag RG81694-CM
MEAF6/C1orf149 cDNA ORF Clone, Rat, N-Myc tag RG81694-NM

MEAF6/C1orf149 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MEAF6/C1orf149 cDNA ORF Clone in Cloning Vector, Human HG16222-G
MEAF6/C1orf149 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16222-ACGLN
MEAF6/C1orf149 cDNA ORF Clone, Human, C-GFPSpark® tag HG16222-ACG
MEAF6/C1orf149 cDNA ORF Clone, Human, N-GFPSpark® tag HG16222-ANG
MEAF6/C1orf149 cDNA ORF Clone, Human, C-OFPSpark® tag HG16222-ACR
MEAF6/C1orf149 cDNA ORF Clone, Human, N-OFPSpark® tag HG16222-ANR
MEAF6/C1orf149 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16222-CF
MEAF6/C1orf149 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16222-NF
MEAF6/C1orf149 cDNA ORF Clone, Human, C-His tag HG16222-CH
MEAF6/C1orf149 cDNA ORF Clone, Human, N-His tag HG16222-NH
MEAF6/C1orf149 cDNA ORF Clone, Human, C-HA tag HG16222-CY
MEAF6/C1orf149 cDNA ORF Clone, Human, N-HA tag HG16222-NY
MEAF6/C1orf149 cDNA ORF Clone, Human, C-Myc tag HG16222-CM
MEAF6/C1orf149 cDNA ORF Clone, Human, N-Myc tag HG16222-NM
MEAF6/C1orf149 qPCR Primer Pairs, Human HP104987
info info
添加购物车成功! 添加购物车失败!