MDM2 cDNA ORF Clone, Human, untagged

Cat: HG11206-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MDM2 Reagents
CRO Services
Product recommended

All MDM2 Reagents
MDM2 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1494 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human MDM2 oncogene, E3 ubiquitin protein ligase.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + NotI (6.1kb + 1.49kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
MDM2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MDM2 cDNA ORF Clone, Human, untagged Validated Images
Human IL12A / IL-12A Gene Plasmid Map 5647
MDM2 cDNA ORF Clone, Human, untagged Alternative Names
ACTFS cDNA ORF Clone, Human;hdm2 cDNA ORF Clone, Human;HDMX cDNA ORF Clone, Human
MDM2 Background Information

MDM2 gene encodes a nuclear-localized E3 ubiquitin ligase. The encoded protein can promote tumor formation by targeting tumor suppressor proteins, such as p53, for proteasomal degradation. This gene is itself transcriptionally-regulated by p53. Overexpression or amplification of this locus is detected in a variety of different cancers. There is a pseudogene for this gene on chromosome 2. Alternative splicing results in a multitude of transcript variants, many of which may be expressed only in tumor cells.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
MDM2 proto-oncogene, E3 ubiquitin protein ligase
References
  • Zhuo X, Ye H, Li Q, Xiang Z, Zhang X. Is MDM2 SNP309 Variation a Risk Factor for Head and Neck Carcinoma?: An Updated Meta-Analysis Based on 11,552 Individuals. Langevin. S, ed. Medicine. 2016;95(9):e2948.
  • MDM2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    MDM2 cDNA ORF Clone in Cloning Vector, Mouse MG50533-M
    MDM2 cDNA ORF Clone, Mouse, untagged MG50533-UT
    MDM2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50533-ACG
    MDM2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50533-ACGLN
    MDM2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50533-ANG
    MDM2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50533-ACR
    MDM2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50533-ANR
    MDM2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50533-CF
    MDM2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50533-NF
    MDM2 cDNA ORF Clone, Mouse, C-His tag MG50533-CH
    MDM2 cDNA ORF Clone, Mouse, N-His tag MG50533-NH
    MDM2 cDNA ORF Clone, Mouse, C-HA tag MG50533-CY
    MDM2 cDNA ORF Clone, Mouse, N-HA tag MG50533-NY
    MDM2 cDNA ORF Clone, Mouse, C-Myc tag MG50533-CM
    MDM2 cDNA ORF Clone, Mouse, N-Myc tag MG50533-NM
    MDM2 qPCR Primer Pairs, Mouse MP200525

    MDM2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    MDM2 cDNA ORF Clone in Cloning Vector, Human HG11206-M
    MDM2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11206-ACG
    MDM2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11206-ACGLN
    MDM2 cDNA ORF Clone, Human, N-GFPSpark® tag HG11206-ANG
    MDM2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11206-ACR
    MDM2 cDNA ORF Clone, Human, N-OFPSpark® tag HG11206-ANR
    MDM2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11206-CF
    MDM2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11206-NF
    MDM2 cDNA ORF Clone, Human, C-His tag HG11206-CH
    MDM2 cDNA ORF Clone, Human, N-His tag HG11206-NH
    MDM2 cDNA ORF Clone, Human, C-HA tag HG11206-CY
    MDM2 cDNA ORF Clone, Human, N-HA tag HG11206-NY
    MDM2 cDNA ORF Clone, Human, C-Myc tag HG11206-CM
    MDM2 cDNA ORF Clone, Human, N-Myc tag HG11206-NM
    MDM2 qPCR Primer Pairs, Human HP101108
    info info
    添加购物车成功! 添加购物车失败!