Quick Order

Human MDM2 Gene ORF cDNA clone expression plasmid, C-His tag

  • Human IL12A / IL-12A Gene Plasmid Map 5643
DatasheetReviewsRelated ProductsProtocols
Human MDM2 cDNA Clone Product Information
NCBI RefSeq:NM_002392.3
RefSeq ORF Size:1539 bp
cDNA Description:Full length Clone DNA of Homo sapiens MDM2 oncogene, E3 ubiquitin protein ligase with C terminal His tag.
Gene Synonym:HDMX, hdm2, MGC5370, MGC71221, MDM2
Species:Human
Vector:pCMV3-C-His
Plasmid:pCMV3-MDM2-His
Restriction Site:KpnI + NotI(6kb+1.54kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with MDM2 qPCR primers for gene expression analysis, HP101108 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

MDM2 gene encodes a nuclear-localized E3 ubiquitin ligase. The encoded protein can promote tumor formation by targeting tumor suppressor proteins, such as p53, for proteasomal degradation. This gene is itself transcriptionally-regulated by p53. Overexpression or amplification of this locus is detected in a variety of different cancers. There is a pseudogene for this gene on chromosome 2. Alternative splicing results in a multitude of transcript variants, many of which may be expressed only in tumor cells.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

References
  • Zhuo X, Ye H, Li Q, Xiang Z, Zhang X. Is MDM2 SNP309 Variation a Risk Factor for Head and Neck Carcinoma?: An Updated Meta-Analysis Based on 11,552 Individuals. Langevin. S, ed. Medicine. 2016;95(9):e2948.
  • Size / Price
    Catalog: HG11206-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"