Midkine cDNA ORF Clone, Human, N-Myc tag

Cat: HG10247-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Midkine Reagents
CRO Services
Product recommended

All Midkine Reagents
Midkine cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
432 bp
Description
Full length Clone DNA of Human midkine (neurite growth-promoting factor 2), transcript variant 2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Midkine cDNA ORF Clone, Human, N-Myc tag Alternative Names
ARAP cDNA ORF Clone, Human;MK cDNA ORF Clone, Human;NEGF2 cDNA ORF Clone, Human
Midkine Background Information

Midkine (MK or MDK) also known as neurite growth-promoting factor 2 (NEGF2) is a basic heparin-binding growth factor of low molecular weight, and forms a family with pleiotrophin. Midkine is a retinoic acid-responsive, heparin-binding growth factor expressed in various cell types during embryogenesis. It promotes angiogenesis, cell growth, and cell migration. Midkine is also expressed in several carcinomas, suggesting that it may play a role in tumorigenesis, perhaps through its effects on angiogenesis. Midkine binds anaplastic lymphoma kinase (ALK) which induces ALK activation and subsequent phosphorylation of the insulin receptor substrate (IRS1), followed by the activation of mitogen-activated protein kinase (MAPK) and PI3-kinase, and the induction of cell proliferation. Midkine is involved in neointima formation after arterial injury, possibly by mediating leukocyte recruitment. Also involved in early fetal adrenal gland development. Midkine exhibited increased expression in the breast carcinomas but showed much lower expression in the normal breast tissue. Thus, it can be used as breast carcinomas marker.

Full Name
midkine (neurite growth-promoting factor 2)
References
  • Kadomatsu K, et al. (2004) Midkine and pleiotrophin in neural development and cancer. Cancer Lett. 204(2): 127-43.
  • Muramatsu H, et al. (1993) Midkine, a retinoic acid-inducible growth/differentiation factor: immunochemical evidence for the function and distribution. Dev Biol. 159(2): 392-402.
  • Muramatsu T. (2002) Midkine and pleiotrophin: two related proteins involved in development, survival, inflammation and tumorigenesis. J Biochem. 132(3): 359-71.
  • Kadomatsu K, et al. (2004) Midkine and pleiotrophin in neural development and cancer. Cancer Lett. 204(2): 127-43.
  • Midkine cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Midkine cDNA ORF Clone in Cloning Vector, Mouse MG53391-U
    Midkine cDNA ORF Clone, Mouse, untagged MG53391-UT
    Midkine Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53391-ACGLN
    Midkine cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53391-ACG
    Midkine cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53391-ACR
    Midkine cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53391-CF
    Midkine cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53391-NF
    Midkine cDNA ORF Clone, Mouse, C-His tag MG53391-CH
    Midkine cDNA ORF Clone, Mouse, N-His tag MG53391-NH
    Midkine cDNA ORF Clone, Mouse, C-HA tag MG53391-CY
    Midkine cDNA ORF Clone, Mouse, N-HA tag MG53391-NY
    Midkine cDNA ORF Clone, Mouse, C-Myc tag MG53391-CM
    Midkine cDNA ORF Clone, Mouse, N-Myc tag MG53391-NM

    Midkine cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Midkine cDNA ORF Clone in Cloning Vector, Human HG10247-M
    Midkine cDNA ORF Clone, Human, untagged HG10247-UT
    Midkine Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10247-ACGLN
    Midkine cDNA ORF Clone, Human, C-GFPSpark® tag HG10247-ACG
    Midkine cDNA ORF Clone, Human, C-OFPSpark® tag HG10247-ACR
    Midkine cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10247-CF
    Midkine cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10247-NF
    Midkine cDNA ORF Clone, Human, C-His tag HG10247-CH
    Midkine cDNA ORF Clone, Human, N-His tag HG10247-NH
    Midkine cDNA ORF Clone, Human, C-HA tag HG10247-CY
    Midkine cDNA ORF Clone, Human, N-HA tag HG10247-NY
    Midkine cDNA ORF Clone, Human, C-Myc tag HG10247-CM
    Midkine qPCR Primer Pairs, Human HP100297
    info info
    添加购物车成功! 添加购物车失败!