Quick Order

Human MDHA / MDH1 Gene ORF cDNA clone expression plasmid, C-Flag tag

    DatasheetReviewsRelated ProductsProtocols
    Human MDH1 cDNA Clone Product Information
    NCBI RefSeq:NM_005917.3
    RefSeq ORF Size:1005bp
    cDNA Description:Full length Clone DNA of Homo sapiens malate dehydrogenase 1, NAD (soluble) with C terminal Flag tag.
    Gene Synonym:MDHA, MOR2, MDH-s, HEL-S-32, MGC:1375
    Species:Human
    Vector:pCMV3-C-FLAG
    Plasmid:
    Restriction Site:
    Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with MDH1 qPCR primers for gene expression analysis, HP105060 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name
    Background

    Malate dehydrogenases 1(MDH1 / MDHA) is soluable form of malate dehydrogenases. Malate dehydrogenases (MDH) is a group of multimeric enzymes consisting of identical subunits usually organized as either dimer or tetramers with subunit molecular weights of 30-35 kDa. MDH has been isolated from different sources including archaea, eubacteria, fungi, plant and mammals. MDH catalyzes the NAD/NADH-dependent interconversion of the substrates malate and oxaloacetate. This reaction plays a key part in the malate / aspartate shuttle across the mitochondrial membrane, and in the tricarboxylic acid cycle within the mitochondrial matrix. The enzymes share a common catalytic mechanism and their kinetic properties are similar, which demonstrates a high degree of structural similarity. The three-dimensional structures and elements essential for catalysis are conserved between mitochondrial and cytoplasmic forms of MDH in eukaryotic cells even though these isoenzymes are only marginally related at the level of primary structure. 

    References
  • Minarik P, et al. (2002) Malate dehydrogenases--structure and function. Gen Physiol Biophys. 21 (3): 257-65.
  • Musrati RA, et al. (1998) Malate dehydrogenase: distribution, function and properties. Gen Physiol Biophys. 17 (3): 193-210.
  • Hall MD, et al. (1992) Crystal structure of Escherichia coli malate dehydrogenase. A complex of the apoenzyme and citrate at 1.87 A resolution. J Mol Biol. 226 (3): 867-82.
  • Size / Price
    Catalog: HG16306-CF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"