MCM3 cDNA ORF Clone, Human, N-Myc tag

Cat: HG15047-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MCM3 Reagents
CRO Services
Product recommended

All MCM3 Reagents
MCM3 cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2472 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human minichromosome maintenance complex component 3 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Restriction Sites
HindIII + NotI(6kb+2.47kb)
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
MCM3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MCM3 cDNA ORF Clone, Human, N-Myc tag Validated Images
Human KRAS/K-RAS Gene Plasmid Map 15924
MCM3 cDNA ORF Clone, Human, N-Myc tag Alternative Names
HCC5 cDNA ORF Clone, Human;P1-MCM3 cDNA ORF Clone, Human;P1.h cDNA ORF Clone, Human;RLFB cDNA ORF Clone, Human
MCM3 Background Information
Full Name
minichromosome maintenance complex component 3

MCM3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MCM3 cDNA ORF Clone in Cloning Vector, Mouse MG53143-G
MCM3 cDNA ORF Clone, Mouse, untagged MG53143-UT
MCM3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53143-ACG
MCM3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53143-ACGLN
MCM3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53143-ANG
MCM3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53143-ACR
MCM3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53143-ANR
MCM3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53143-CF
MCM3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53143-NF
MCM3 cDNA ORF Clone, Mouse, C-His tag MG53143-CH
MCM3 cDNA ORF Clone, Mouse, N-His tag MG53143-NH
MCM3 cDNA ORF Clone, Mouse, C-HA tag MG53143-CY
MCM3 cDNA ORF Clone, Mouse, N-HA tag MG53143-NY
MCM3 cDNA ORF Clone, Mouse, C-Myc tag MG53143-CM
MCM3 cDNA ORF Clone, Mouse, N-Myc tag MG53143-NM

MCM3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MCM3 cDNA ORF Clone in Cloning Vector, Human HG15047-G
MCM3 cDNA ORF Clone, Human, untagged HG15047-UT
MCM3 cDNA ORF Clone, Human, C-GFPSpark® tag HG15047-ACG
MCM3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15047-ACGLN
MCM3 cDNA ORF Clone, Human, N-GFPSpark® tag HG15047-ANG
MCM3 cDNA ORF Clone, Human, C-OFPSpark® tag HG15047-ACR
MCM3 cDNA ORF Clone, Human, N-OFPSpark® tag HG15047-ANR
MCM3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15047-CF
MCM3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15047-NF
MCM3 cDNA ORF Clone, Human, C-His tag HG15047-CH
MCM3 cDNA ORF Clone, Human, N-His tag HG15047-NH
MCM3 cDNA ORF Clone, Human, C-HA tag HG15047-CY
MCM3 cDNA ORF Clone, Human, N-HA tag HG15047-NY
MCM3 cDNA ORF Clone, Human, C-Myc tag HG15047-CM
MCM3 qPCR Primer Pairs, Human HP103675
info info
添加购物车成功! 添加购物车失败!