Quick Order

Human MAVS Gene ORF cDNA clone expression plasmid

  • other Green fluorescent protein / GFP Gene Plasmid Map 5613
DatasheetReviewsRelated ProductsProtocols
Human MAVS cDNA Clone Product Information
NCBI RefSeq:BC044952
RefSeq ORF Size:1623bp
cDNA Description:Full length Clone DNA of Homo sapiens mitochondrial antiviral signaling protein DNA.
Gene Synonym:IPS1, VISA, IPS-1, CARDIF
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-MAVS
Restriction Site:KpnI + XbaI(6kb+1.62kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with MAVS qPCR primers for gene expression analysis, HP103850 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG15224-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Add to CartBulk Discount Inquiry

Datasheet & Documentation

Contact Us
    Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"