MASTL/THC2 cDNA ORF Clone, Human, untagged

Cat: HG10761-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MASTL/THC2 Reagents
CRO Services
Product recommended

All MASTL/THC2 Reagents
MASTL/THC2 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2637 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1782 C>T not causing the amino acid variation.
Description
Full length Clone DNA of Human microtubule associated serine/threonine kinase-like.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
HindIII + NotI (6.1kb + 2.64kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
MASTL/THC2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MASTL/THC2 cDNA ORF Clone, Human, untagged Validated Images
Human CD112/Nectin-2/PVRL2 Gene Plasmid Map 5681
MASTL/THC2 cDNA ORF Clone, Human, untagged Alternative Names
GREATWALL cDNA ORF Clone, Human;GW cDNA ORF Clone, Human;GWL cDNA ORF Clone, Human;hGWL cDNA ORF Clone, Human;MAST-L cDNA ORF Clone, Human;THC2 cDNA ORF Clone, Human
MASTL/THC2 Background Information
Full Name
microtubule associated serine/threonine kinase-like

MASTL/THC2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MASTL/THC2 cDNA ORF Clone in Cloning Vector, Mouse MG51040-G
MASTL/THC2 cDNA ORF Clone, Mouse, untagged MG51040-UT
MASTL/THC2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51040-ACGLN
MASTL/THC2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51040-ACG
MASTL/THC2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51040-ANG
MASTL/THC2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51040-ACR
MASTL/THC2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51040-ANR
MASTL/THC2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51040-CF
MASTL/THC2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51040-NF
MASTL/THC2 cDNA ORF Clone, Mouse, C-His tag MG51040-CH
MASTL/THC2 cDNA ORF Clone, Mouse, N-His tag MG51040-NH
MASTL/THC2 cDNA ORF Clone, Mouse, C-HA tag MG51040-CY
MASTL/THC2 cDNA ORF Clone, Mouse, N-HA tag MG51040-NY
MASTL/THC2 cDNA ORF Clone, Mouse, C-Myc tag MG51040-CM
MASTL/THC2 cDNA ORF Clone, Mouse, N-Myc tag MG51040-NM
MASTL/THC2 qPCR Primer Pairs, Mouse MP200999

MASTL/THC2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MASTL/THC2 cDNA ORF Clone in Cloning Vector, Human HG10761-M
MASTL/THC2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10761-ACGLN
MASTL/THC2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10761-ACG
MASTL/THC2 cDNA ORF Clone, Human, N-GFPSpark® tag HG10761-ANG
MASTL/THC2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10761-ACR
MASTL/THC2 cDNA ORF Clone, Human, N-OFPSpark® tag HG10761-ANR
MASTL/THC2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10761-CF
MASTL/THC2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10761-NF
MASTL/THC2 cDNA ORF Clone, Human, C-His tag HG10761-CH
MASTL/THC2 cDNA ORF Clone, Human, N-His tag HG10761-NH
MASTL/THC2 cDNA ORF Clone, Human, C-HA tag HG10761-CY
MASTL/THC2 cDNA ORF Clone, Human, N-HA tag HG10761-NY
MASTL/THC2 cDNA ORF Clone, Human, C-Myc tag HG10761-CM
MASTL/THC2 cDNA ORF Clone, Human, N-Myc tag HG10761-NM
MASTL/THC2 qPCR Primer Pairs, Human HP100687
info info
添加购物车成功! 添加购物车失败!