Quick Order

Human MASTL/THC2 Gene ORF cDNA clone expression plasmid

  • Human MASTL / THC2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatasheetReviewsRelated ProductsProtocols
Human MASTL cDNA Clone Product Information
NCBI RefSeq:NM_032844.2
RefSeq ORF Size:2637bp
cDNA Description:Full length Clone DNA of Homo sapiens microtubule associated serine/threonine kinase-like.
Gene Synonym:THC2, FLJ14813, RP11-85G18.2, MASTL
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-MASTL
Restriction Site:HindIII + NotI (6.1kb + 2.64kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1782 C>T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with MASTL qPCR primers for gene expression analysis, HP100687 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human MASTL Gene Plasmid Map
Human MASTL / THC2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: HG10761-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability
Add to CartBulk Discount Inquiry

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"