Mark3 cDNA ORF Clone, Human, C-His tag

Cat: HG12181-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Mark3 Reagents
CRO Services
Product recommended

All Mark3 Reagents
Mark3 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2235 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human MAP/microtubule affinity-regulating kinase 3 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Restriction Sites
KpnI + NotI(6kb+2.24kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Mark3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Mark3 cDNA ORF Clone, Human, C-His tag Validated Images
Human IL12A / IL-12A Gene Plasmid Map 5643
Mark3 cDNA ORF Clone, Human, C-His tag Alternative Names
CTAK1 cDNA ORF Clone, Human;KP78 cDNA ORF Clone, Human;Par-1a cDNA ORF Clone, Human;PAR1A cDNA ORF Clone, Human
Mark3 Background Information

MAP / microtubule affinity-regulating kinase 3, also known as C-TAK1, cTAK1, Cdc25C-associated protein kinase 1, ELKL motif kinase 2, Protein kinase STK10, Ser/Thr protein kinase PAR-1, Serine/threonine-protein kinase p78, MARK3, CTAK1 and EMK2, is a ubiquitous expressed protein which belongs to the protein kinase superfamily, CAMK Ser / Thr protein kinase family and MARK subfamily. MARK3 contains one KA1 (kinase-associated) domain, one protein kinase domain and one UBA domain. The Par-1 / MARK protein kinases play a pivotal role in establishing cellular polarity. This family of kinases contains a unique domain architecture, in which a ubiquitin-associated (UBA) domain is located C-terminal to the kinase domain. MARKs / PAR-1 are common regulators of cell polarity that are conserved from nematode to human. All of these kinases have a highly conserved C-terminal domain, which is termed the kinase-associated domain 1 (KA1).

Full Name
MAP/microtubule affinity-regulating kinase 3
References
  • Kato,T. et al., 2001, Neoplasia.3 (1):4-9.
  • Tochio,N. et al., 2006, Protein Sci. 15 (11):2534-43.
  • Murphy,J.M. et al., 2007, Proc Natl Acad Sci USA.104 (36):14336-41.
  • de Leng,W.W. et al., 2007,Clin Genet. 72 (6):568-73.
  • Chia,C.Y. et al., 2010, IUBMB Life. 62 (3):200-3.
  • info info
    添加购物车成功! 添加购物车失败!