After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human MAPT / Tau transcript variant 4 ORF mammalian expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Human MAPT cDNA Clone Product Information
NCBI RefSeq:NM_016841.2
RefSeq ORF Size:1059bp
cDNA Description:Full length Clone DNA of Homo sapiens microtubule-associated protein tau (MAPT), transcript variant 4 with C terminal Myc tag.
Gene Synonym:MAPT, TAU, MSTD, PPND, DDPAC, MAPTL, MTBT1, MTBT2, FTDP-17
Species:Human
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

MAPT (microtubule-associated protein tau) can produce tau proteins. Tau proteins are proteins that stabilize microtubules. They are abundant in neurons of the central nervous system and are less common elsewhere, but are also expressed at very low levels in CNS astrocytes and oligodendrocytes. When tau proteins are defective, and no longer stabilize microtubules properly, they can result in dementias such as Alzheimer's disease. Tau protein is a highly soluble microtubule-associated protein (MAP). In humans, these proteins are mostly found in neurons compared to non-neuronal cells. One of tau's main functions is to modulate the stability of axonal microtubules. Other nervous system MAPs may perform similar functions, as suggested by tau knockout mice, who did not show abnormalities in brain development - possibly because of compensation in tau deficiency by other MAPs.

References
  • Harada A, et al. (1994) Altered microtubule organization in small-calibre axons of mice lacking tau protein. Nature. 369(6480):488-91.
  • Weingarten MD, et al. (1975) A protein factor essential for microtubule assembly. Proc Natl Acad Sci. 72(5):1858-62.
  • Goedert M, et al. (1989) Multiple isoforms of human microtubule-associated protein tau: sequences and localization in neurofibrillary tangles of Alzheimer's disease. Neuron. 3(4): 519-26.
  • Size / Price
    Catalog: HG10058-CM
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"