EB3 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG14614-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All EB3 Reagents
CRO Services
Product recommended

All EB3 Reagents
EB3 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
885 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human microtubule-associated protein, RP/EB family, member 3 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Restriction Sites
KpnI + XbaI(6kb+0.89kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
EB3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

EB3 cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Human aFGF/FGF1 Gene Plasmid Map 5637
Human MAPRE3 / EB3 Gene Expression validated Image 16628
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
EB3 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
EB3 cDNA ORF Clone, Human;EBF3 cDNA ORF Clone, Human;EBF3-S cDNA ORF Clone, Human;RP3 cDNA ORF Clone, Human
EB3 Background Information

MAPRE3, also known as EB3, is a member of the RP/EB family. MAPRE3 localizes to the cytoplasmic microtubule network and binds APCL. MAPRE3 regulates the dynamics of the microtubule cytoskeleton. It also promotes microtubule growth. MAPRE3 may be involved in spindle function by stabilizing microtubules and anchoring them at centrosomes. MAPRE3 may also play a role in cell migration.

Full Name
microtubule-associated protein, RP/EB family, member 3
References
  • Rual JF. et al., 2005, Nature. 437 (7062): 1173-8.
  • Yeh TY. et al., 2005, J Cell Sci. 118 (15): 3431-43.
  • Mimori-Kiyosue Y. et al., 2005, J Cell Biol. 168 (1): 141-53.
  • EB3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    EB3 cDNA ORF Clone in Cloning Vector, Mouse MG51507-G
    EB3 cDNA ORF Clone, Mouse, untagged MG51507-UT
    EB3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51507-ACG
    EB3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51507-ACGLN
    EB3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51507-ANG
    EB3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51507-ACR
    EB3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51507-ANR
    EB3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51507-CF
    EB3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51507-NF
    EB3 cDNA ORF Clone, Mouse, C-His tag MG51507-CH
    EB3 cDNA ORF Clone, Mouse, N-His tag MG51507-NH
    EB3 cDNA ORF Clone, Mouse, C-HA tag MG51507-CY
    EB3 cDNA ORF Clone, Mouse, N-HA tag MG51507-NY
    EB3 cDNA ORF Clone, Mouse, C-Myc tag MG51507-CM
    EB3 cDNA ORF Clone, Mouse, N-Myc tag MG51507-NM
    EB3 qPCR Primer Pairs, Mouse MP201391

    EB3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    EB3 cDNA ORF Clone in Cloning Vector, Human HG14614-G
    EB3 cDNA ORF Clone, Human, untagged HG14614-UT
    EB3 cDNA ORF Clone, Human, C-GFPSpark® tag HG14614-ACG
    EB3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14614-ACGLN
    EB3 cDNA ORF Clone, Human, N-GFPSpark® tag HG14614-ANG
    EB3 cDNA ORF Clone, Human, C-OFPSpark® tag HG14614-ACR
    EB3 cDNA ORF Clone, Human, N-OFPSpark® tag HG14614-ANR
    EB3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14614-CF
    EB3 cDNA ORF Clone, Human, C-His tag HG14614-CH
    EB3 cDNA ORF Clone, Human, N-His tag HG14614-NH
    EB3 cDNA ORF Clone, Human, C-HA tag HG14614-CY
    EB3 cDNA ORF Clone, Human, N-HA tag HG14614-NY
    EB3 cDNA ORF Clone, Human, C-Myc tag HG14614-CM
    EB3 cDNA ORF Clone, Human, N-Myc tag HG14614-NM
    EB3 qPCR Primer Pairs, Human HP103248
    info info
    添加购物车成功! 添加购物车失败!