Text Size:AAA

Human MAPRE3 / EB3 Gene ORF cDNA clone expression plasmid, C-OFPSpark tag

  • other Green fluorescent protein / GFP Gene Plasmid Map 5608
DatasheetReviewsRelated ProductsProtocols
Human MAPRE3 cDNA Clone Product Information
NCBI RefSeq:BC011557
RefSeq ORF Size:1533 bp
cDNA Description:Full length Clone DNA of Homo sapiens microtubule-associated protein, RP/EB family, member 3 with C terminal OFPSpark / RFP tag.
Gene Synonym:EB3, RP3, EBF3, EBF3-S
Species:Human
Vector:pCMV3-C-OFPSpark
Plasmid:pCMV3-MAPRE3-OFPSpark
Restriction Site:KpnI + XbaI(6kb+1.53kb)
Tag Sequence:OFPSpark Tag: GATAGCACTGAG……CACCTGTTCCAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with MAPRE3 qPCR primers for gene expression analysis, HP103248 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
OFP (OFPSpark) / RFP Tag Info

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Product nameProduct name
Background

MAPRE3, also known as EB3, is a member of the RP/EB family. MAPRE3 localizes to the cytoplasmic microtubule network and binds APCL. MAPRE3 regulates the dynamics of the microtubule cytoskeleton. It also promotes microtubule growth. MAPRE3 may be involved in spindle function by stabilizing microtubules and anchoring them at centrosomes. MAPRE3 may also play a role in cell migration.

References
  • Rual JF. et al., 2005, Nature. 437 (7062): 1173-8.
  • Yeh TY. et al., 2005, J Cell Sci. 118 (15): 3431-43.
  • Mimori-Kiyosue Y. et al., 2005, J Cell Biol. 168 (1): 141-53.
  • Size / Price
    Catalog: HG14614-ACR
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"