p38 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG10081-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All p38 Reagents
CRO Services
Product recommended

All p38 Reagents
p38 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1083 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human mitogen-activated protein kinase 14 transcript variant 2 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Restriction Sites
KpnI + XbaI (6kb + 1.13kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
p38 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

p38 cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Human aFGF/FGF1 Gene Plasmid Map 5637
p38 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
CSBP cDNA ORF Clone, Human;CSBP1 cDNA ORF Clone, Human;CSBP2 cDNA ORF Clone, Human;CSPB1 cDNA ORF Clone, Human;EXIP cDNA ORF Clone, Human;Mxi2 cDNA ORF Clone, Human;p38 cDNA ORF Clone, Human;p38ALPHA cDNA ORF Clone, Human;PRKM14 cDNA ORF Clone, Human;PRKM15 cDNA ORF Clone, Human;RK cDNA ORF Clone, Human;SAPK2A cDNA ORF Clone, Human
p38 Background Information

MAPK14 contains 1 protein kinase domain and belongs to the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. MAPK14 can be detected in brain, heart, placenta, pancreas and skeletal muscle and it is expressed to a lesser extent in lung, liver and kidney. MAPK14 is activated by various environmental stresses and proinflammatory cytokines. The activation requires its phosphorylation by MAP kinase kinases (MKKs), or its autophosphorylation triggered by the interaction of MAP3K7IP1/TAB1 protein with MAPK14. The substrates of p38 alpha include transcription regulator ATF2, MEF2C, and MAX, cell cycle regulator CDC25B, and tumor suppressor p53, which suggest the roles of p38 alpha in stress related transcription and cell cycle regulation, as well as in genotoxic stress response. In respond to activation by environmental stress, pro-inflammatory cytokines and lipopolysaccharide, MAPK14 phosphorylates a number of transcription factors, such as ELK1 and ATF2 and several downstream kinases, such as MAPKAPK2 and MAPKAPK5. MAPK14 plays a critical role in the production of some cytokines, for example IL-6. It may play a role in stabilization of EPO mRNA during hypoxic stress. Isoform Mxi2 activation is stimulated by mitogens and oxidative stress and only poorly phosphorylates ELK1 and ATF2.

Full Name
mitogen-activated protein kinase 14
Research Areas
References
  • Luo X, et al. (2011) Study on p38 mitogen activated protein kinase in vascular endothelial cells dysfunction in preeclampsia. Zhonghua Fu Chan Ke Za Zhi. 46(1):36-40.
  • Park CH, et al. (2011) Epidermal growth factor-induced matrix metalloproteinase-1 expression is negatively regulated by p38 MAPK in human skin fibroblasts. J Dermatol Sci. 64(2):134-41.
  • Lee JY, et al. (2011) Curcumin induces EGFR degradation in lung adenocarcinoma and modulates p38 activation in intestine: the versatile adjuvant for gefitinib therapy. PLoS One. 6(8):e23756.
  • Riis JL, et al. (2011) CCL27 expression is regulated by both p38 MAPK and IKKβ signalling pathways. Cytokine. 56(3):699-707.
  • p38 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    p38 cDNA ORF Clone in Cloning Vector, Rat RG81736-U
    p38 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81736-ACGLN

    p38 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    p38 cDNA ORF Clone in Cloning Vector, Mouse MG50825-G
    p38 cDNA ORF Clone, Mouse, untagged MG50825-UT
    p38 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50825-ACG
    p38 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50825-ACGLN
    p38 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50825-ANG
    p38 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50825-ACR
    p38 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50825-ANR
    p38 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50825-CF
    p38 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50825-NF
    p38 cDNA ORF Clone, Mouse, C-His tag MG50825-CH
    p38 cDNA ORF Clone, Mouse, N-His tag MG50825-NH
    p38 cDNA ORF Clone, Mouse, C-HA tag MG50825-CY
    p38 cDNA ORF Clone, Mouse, N-HA tag MG50825-NY
    p38 cDNA ORF Clone, Mouse, C-Myc tag MG50825-CM
    p38 cDNA ORF Clone, Mouse, N-Myc tag MG50825-NM
    p38 qPCR Primer Pairs, Mouse MP200796

    p38 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    p38 cDNA ORF Clone in Cloning Vector, Human HG10646-M
    p38 cDNA ORF Clone in Cloning Vector, Human HG10081-M
    p38 cDNA ORF Clone, Human, untagged HG10081-UT
    p38 cDNA ORF Clone, Human, untagged HG10646-UT
    p38 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10081-ACGLN
    p38 cDNA ORF Clone, Human, C-GFPSpark® tag HG10646-ACG
    p38 cDNA ORF Clone, Human, C-GFPSpark® tag HG10081-ACG
    p38 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10646-ACGLN
    p38 cDNA ORF Clone, Human, N-GFPSpark® tag HG10081-ANG
    p38 cDNA ORF Clone, Human, N-GFPSpark® tag HG10646-ANG
    p38 cDNA ORF Clone, Human, C-OFPSpark® tag HG10081-ACR
    p38 cDNA ORF Clone, Human, C-OFPSpark® tag HG10646-ACR
    p38 cDNA ORF Clone, Human, N-OFPSpark® tag HG10081-ANR
    p38 cDNA ORF Clone, Human, N-OFPSpark® tag HG10646-ANR
    p38 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10646-CF
    p38 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10081-CF
    p38 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10646-NF
    p38 cDNA ORF Clone, Human, C-His tag HG10646-CH
    p38 cDNA ORF Clone, Human, C-His tag HG10081-CH
    p38 cDNA ORF Clone, Human, N-His tag HG10646-NH
    p38 cDNA ORF Clone, Human, N-His tag HG10081-NH
    p38 cDNA ORF Clone, Human, C-HA tag HG10081-CY
    p38 cDNA ORF Clone, Human, C-HA tag HG10646-CY
    p38 cDNA ORF Clone, Human, N-HA tag HG10081-NY
    p38 cDNA ORF Clone, Human, N-HA tag HG10646-NY
    p38 cDNA ORF Clone, Human, C-Myc tag HG10081-CM
    p38 cDNA ORF Clone, Human, C-Myc tag HG10646-CM
    p38 cDNA ORF Clone, Human, N-Myc tag HG10081-NM
    p38 cDNA ORF Clone, Human, N-Myc tag HG10646-NM
    p38 qPCR Primer Pairs, Human HP100167
    info info
    添加购物车成功! 添加购物车失败!