Quick Order

Human p38 alpha/MAPK14 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Human MAPK14 cDNA Clone Product Information
NCBI RefSeq:NM_001315.2
RefSeq ORF Size:1083bp
cDNA Description:Full length Clone DNA of Homo sapiens mitogen-activated protein kinase 14, transcript variant 1 with N terminal HA tag.
Gene Synonym:RK, p38, EXIP, Mxi2, CSBP1, CSBP2, CSPB1, PRKM14, PRKM15, SAPK2A, p38ALPHA
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human p38 alpha/MAPK14 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tag on other vectors
Human p38 alpha/MAPK14 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10646-ACG$225
Human p38 alpha/MAPK14 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10646-ACR$225
Human p38 alpha/MAPK14 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10646-ANG$225
Human p38 alpha/MAPK14 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10646-ANR$225
Human p38 alpha/MAPK14 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10646-CF$195
Human p38 alpha/MAPK14 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tagHG10646-CH$195
Human p38 alpha/MAPK14 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10646-CM$195
Human p38 alpha/MAPK14 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tagHG10646-CY$195
Human p38 alpha/MAPK14 transcript variant 1 Gene ORF cDNA clone in cloning vectorHG10646-M$75
Human p38 alpha/MAPK14 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10646-M-F$195
Human p38 alpha/MAPK14 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10646-NF$195
Human p38 alpha/MAPK14 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tagHG10646-NH$195
Human p38 alpha/MAPK14 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10646-NM$195
Human p38 alpha/MAPK14 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tagHG10646-NY$195
Human p38 alpha/MAPK14 transcript variant 1 Gene ORF cDNA clone expression plasmidHG10646-UT$195
 Learn more about expression Vectors
Product nameProduct name
Background

MAPK14 contains 1 protein kinase domain and belongs to the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. MAPK14 can be detected in brain, heart, placenta, pancreas and skeletal muscle and it is expressed to a lesser extent in lung, liver and kidney. MAPK14 is activated by various environmental stresses and proinflammatory cytokines. The activation requires its phosphorylation by MAP kinase kinases (MKKs), or its autophosphorylation triggered by the interaction of MAP3K7IP1/TAB1 protein with MAPK14. The substrates of p38 alpha include transcription regulator ATF2, MEF2C, and MAX, cell cycle regulator CDC25B, and tumor suppressor p53, which suggest the roles of p38 alpha in stress related transcription and cell cycle regulation, as well as in genotoxic stress response. In respond to activation by environmental stress, pro-inflammatory cytokines and lipopolysaccharide, MAPK14 phosphorylates a number of transcription factors, such as ELK1 and ATF2 and several downstream kinases, such as MAPKAPK2 and MAPKAPK5. MAPK14 plays a critical role in the production of some cytokines, for example IL-6. It may play a role in stabilization of EPO mRNA during hypoxic stress. Isoform Mxi2 activation is stimulated by mitogens and oxidative stress and only poorly phosphorylates ELK1 and ATF2.

References
  • Luo X, et al. (2011) Study on p38 mitogen activated protein kinase in vascular endothelial cells dysfunction in preeclampsia. Zhonghua Fu Chan Ke Za Zhi. 46(1):36-40.
  • Park CH, et al. (2011) Epidermal growth factor-induced matrix metalloproteinase-1 expression is negatively regulated by p38 MAPK in human skin fibroblasts. J Dermatol Sci. 64(2):134-41.
  • Lee JY, et al. (2011) Curcumin induces EGFR degradation in lung adenocarcinoma and modulates p38 activation in intestine: the versatile adjuvant for gefitinib therapy. PLoS One. 6(8):e23756.
  • Riis JL, et al. (2011) CCL27 expression is regulated by both p38 MAPK and IKKβ signalling pathways. Cytokine. 56(3):699-707.
  • Size / Price
    Catalog: HG10646-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"