Quick Order

Text Size:AAA

Human MAPK10/JNK3 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Human MAPK10 cDNA Clone Product Information
NCBI RefSeq:NM_002753.2
RefSeq ORF Size:1269bp
cDNA Description:Full length Clone DNA of Homo sapiens mitogen-activated protein kinase 10, transcript variant 1 with C terminal HA tag.
Gene Synonym:JNK3, JNK3A, PRKM10, p493F12, FLJ12099, FLJ33785, MGC50974, p54bSAPK
Species:Human
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human MAPK10/JNK3 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tag on other vectors
Human MAPK10/JNK3 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10626-ACG$225
Human MAPK10/JNK3 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10626-ACR$225
Human MAPK10/JNK3 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10626-ANG$225
Human MAPK10/JNK3 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10626-ANR$225
Human MAPK10/JNK3 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10626-CF$195
Human MAPK10/JNK3 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tagHG10626-CH$195
Human MAPK10/JNK3 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10626-CM$195
Human MAPK10/JNK3 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tagHG10626-CY$195
Human MAPK10/JNK3 transcript variant 1 Gene ORF cDNA clone in cloning vectorHG10626-M$75
Human MAPK10/JNK3 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10626-M-F$195
Human MAPK10/JNK3 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10626-NF$195
Human MAPK10/JNK3 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tagHG10626-NH$195
Human MAPK10/JNK3 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10626-NM$195
Human MAPK10/JNK3 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tagHG10626-NY$195
Human MAPK10/JNK3 transcript variant 1 Gene ORF cDNA clone expression plasmidHG10626-UT$195
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: HG10626-CY
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"