ERK2 cDNA ORF Clone, Human, C-HA tag

Cat: HG10030-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ERK2 Reagents
CRO Services
Product recommended

All ERK2 Reagents
ERK2 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1125 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human mitogen-activated protein kinase 1 (MAPK1), transcript variant 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Restriction Sites
KpnI + XbaI(6kb+1.13kb)
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
ERK2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ERK2 cDNA ORF Clone, Human, C-HA tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5612
ERK2 cDNA ORF Clone, Human, C-HA tag Alternative Names
ERK cDNA ORF Clone, Human;ERK-2 cDNA ORF Clone, Human;ERK2 cDNA ORF Clone, Human;ERT1 cDNA ORF Clone, Human;MAPK2 cDNA ORF Clone, Human;p38 cDNA ORF Clone, Human;p40 cDNA ORF Clone, Human;p41 cDNA ORF Clone, Human;p41mapk cDNA ORF Clone, Human;p42-MAPK cDNA ORF Clone, Human;P42MAPK cDNA ORF Clone, Human;PRKM1 cDNA ORF Clone, Human;PRKM2 cDNA ORF Clone, Human
ERK2 Background Information

MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. ERK is a versatile protein kinase that regulates many cellular functions. Growing evidence suggests that extracellular signal-regulated protein kinase 1/2 (ERK1/2) plays a crucial role in promoting cell death in a variety of neuronal systems, including neurodegenerative diseases. It is believed that the magnitude and the duration of ERK1/2 activity determine its cellular function. Activation of ERK1/2 are implicated in the pathophysiology of spinal cord injury (SCI). ERK2 signaling is a novel target associated with the deleterious consequences of spinal injury. ERK-2, also known as Mitogen-activated protein kinase 1 (MAPK1), is a member of the protein kinase superfamily and MAP kinase subfamily. MKP-3 is a dual specificity phosphatase exclusively specific to MAPK1 for its substrate recognition and dephosphorylating activity. The activation of MAPK1 requires its phosphorylation by upstream kinases. Upon activation, MAPK1 translocates to the nucleus of the stimulated cells, where it phosphorylates nuclear targets. MAPK1 is involved in both the initiation and regulation of meiosis, mitosis, and postmitotic functions in differentiated cells by phosphorylating a number of transcription factors such as ELK1. MAPK1 acts as a transcriptional repressor which represses the expression of interferon gamma-induced genes. Transcriptional activity is independent of kinase activity. The nuclear-cytoplasmic distribution of ERK2 is regulated in response to various stimuli and changes in cell context. Furthermore, the nuclear flux of ERK2 occurs by several energy- and carrier-dependent and -independent mechanisms. ERK2 has been shown to translocate into and out of the nucleus by facilitated diffusion through the nuclear pore, interacting directly with proteins within the nuclear pore complex, as well as by karyopherin-mediated transport. ERK2 interacts with the PDE4 catalytic unit by binding to a KIM (kinase interaction motif) docking site located on an exposed beta-hairpin loop and an FQF (Phe-Gln-Phe) specificity site located on an exposed alpha-helix. These flank a site that allows phosphorylation by ERK, the functional outcome of which is orchestrated by the N-terminal UCR1/2 (upstream conserved region 1 and 2) modules.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
mitogen-activated protein kinase 1
Research Areas
References
  • Houslay MD, et al. (2003) The role of ERK2 docking and phosphorylation of PDE4 cAMP phosphodiesterase isoforms in mediating cross-talk between the cAMP and ERK signalling pathways. Biochem Soc Trans. 31(Pt 6): 1186-90.
  • Jivan A, et al. (2010) Reconstitution of the Nuclear Transport of the MAP Kinase ERK2. Methods Mol Biol. 661: 273-85.
  • Yu CG, et al. (2010) Involvement of ERK2 in traumatic spinal cord injury. J Neurochem. 113(1): 131-42.
  • Subramaniam S, et al. (2010) ERK and cell death: ERK1/2 in neuronal death. FEBS J. 277(1): 22-9.
  • ERK2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    ERK2 cDNA ORF Clone in Cloning Vector, Mouse MG50445-G
    ERK2 cDNA ORF Clone, Mouse, untagged MG50445-UT
    ERK2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50445-ACGLN
    ERK2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50445-ACG
    ERK2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50445-ANG
    ERK2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50445-ACR
    ERK2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50445-ANR
    ERK2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50445-CF
    ERK2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50445-NF
    ERK2 cDNA ORF Clone, Mouse, C-His tag MG50445-CH
    ERK2 cDNA ORF Clone, Mouse, N-His tag MG50445-NH
    ERK2 cDNA ORF Clone, Mouse, C-HA tag MG50445-CY
    ERK2 cDNA ORF Clone, Mouse, N-HA tag MG50445-NY
    ERK2 cDNA ORF Clone, Mouse, C-Myc tag MG50445-CM
    ERK2 cDNA ORF Clone, Mouse, N-Myc tag MG50445-NM
    ERK2 qPCR Primer Pairs, Mouse MP200454

    ERK2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ERK2 cDNA ORF Clone in Cloning Vector, Human HG10030-M
    ERK2 cDNA ORF Clone, Human, untagged HG10030-UT
    ERK2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10030-ACG
    ERK2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10030-ACGLN
    ERK2 cDNA ORF Clone, Human, N-GFPSpark® tag HG10030-ANG
    ERK2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10030-ACR
    ERK2 cDNA ORF Clone, Human, N-OFPSpark® tag HG10030-ANR
    ERK2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10030-CF
    ERK2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10030-NF
    ERK2 cDNA ORF Clone, Human, C-His tag HG10030-CH
    ERK2 cDNA ORF Clone, Human, N-His tag HG10030-NH
    ERK2 cDNA ORF Clone, Human, N-HA tag HG10030-NY
    ERK2 cDNA ORF Clone, Human, C-Myc tag HG10030-CM
    ERK2 cDNA ORF Clone, Human, N-Myc tag HG10030-NM
    ERK2 qPCR Primer Pairs, Human HP100125
    info info
    添加购物车成功! 添加购物车失败!