After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Human MAPK1 cDNA Clone Product Information
NCBI RefSeq:NM_002745.4
RefSeq ORF Size:1083bp
cDNA Description:Full length Clone DNA of Homo sapiens mitogen-activated protein kinase 1 (MAPK1), transcript variant 1 with N terminal HA tag.
Gene Synonym:MAPK1, ERK, p38, p40, p41, ERK2, ERT1, MAPK2, PRKM1, PRKM2, P42MAPK, p41mapk
Species:Human
Vector:pCMV3-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tag on other vectors
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-GFPSpark tagHG10030-ACG$225
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-OFPSpark tagHG10030-ACR$225
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-GFPSpark tagHG10030-ANG$225
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-OFPSpark tagHG10030-ANR$225
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10030-CF$195
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-His tagHG10030-CH$195
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Myc tagHG10030-CM$195
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-HA tagHG10030-CY$195
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene ORF cDNA clone in cloning vectorHG10030-M$75
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tagHG10030-M-F$195
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Flag tagHG10030-NF$195
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-His tagHG10030-NH$195
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-Myc tagHG10030-NM$195
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tagHG10030-NY$195
Human ERK2/MAPK1/MAPK2 transcript variant 1 Gene ORF cDNA clone expression plasmidHG10030-UT$195
 Learn more about expression Vectors
Product nameProduct name
Background

MAP kinases, also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. ERK is a versatile protein kinase that regulates many cellular functions. Growing evidence suggests that extracellular signal-regulated protein kinase 1/2 (ERK1/2) plays a crucial role in promoting cell death in a variety of neuronal systems, including neurodegenerative diseases. It is believed that the magnitude and the duration of ERK1/2 activity determine its cellular function. Activation of ERK1/2 are implicated in the pathophysiology of spinal cord injury (SCI). ERK2 signaling is a novel target associated with the deleterious consequences of spinal injury. ERK-2, also known as Mitogen-activated protein kinase 1 (MAPK1), is a member of the protein kinase superfamily and MAP kinase subfamily. MKP-3 is a dual specificity phosphatase exclusively specific to MAPK1 for its substrate recognition and dephosphorylating activity. The activation of MAPK1 requires its phosphorylation by upstream kinases. Upon activation, MAPK1 translocates to the nucleus of the stimulated cells, where it phosphorylates nuclear targets. MAPK1 is involved in both the initiation and regulation of meiosis, mitosis, and postmitotic functions in differentiated cells by phosphorylating a number of transcription factors such as ELK1. MAPK1 acts as a transcriptional repressor which represses the expression of interferon gamma-induced genes. Transcriptional activity is independent of kinase activity. The nuclear-cytoplasmic distribution of ERK2 is regulated in response to various stimuli and changes in cell context. Furthermore, the nuclear flux of ERK2 occurs by several energy- and carrier-dependent and -independent mechanisms. ERK2 has been shown to translocate into and out of the nucleus by facilitated diffusion through the nuclear pore, interacting directly with proteins within the nuclear pore complex, as well as by karyopherin-mediated transport. ERK2 interacts with the PDE4 catalytic unit by binding to a KIM (kinase interaction motif) docking site located on an exposed beta-hairpin loop and an FQF (Phe-Gln-Phe) specificity site located on an exposed alpha-helix. These flank a site that allows phosphorylation by ERK, the functional outcome of which is orchestrated by the N-terminal UCR1/2 (upstream conserved region 1 and 2) modules.

References
  • Houslay MD, et al. (2003) The role of ERK2 docking and phosphorylation of PDE4 cAMP phosphodiesterase isoforms in mediating cross-talk between the cAMP and ERK signalling pathways. Biochem Soc Trans. 31(Pt 6): 1186-90.
  • Jivan A, et al. (2010) Reconstitution of the Nuclear Transport of the MAP Kinase ERK2. Methods Mol Biol. 661: 273-85.
  • Yu CG, et al. (2010) Involvement of ERK2 in traumatic spinal cord injury. J Neurochem. 113(1): 131-42.
  • Subramaniam S, et al. (2010) ERK and cell death: ERK1/2 in neuronal death. FEBS J. 277(1): 22-9.
  • Size / Price
    Catalog: HG10030-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"