MAP3K8 cDNA ORF Clone, Human, untagged

Cat: HG10800-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MAP3K8 Reagents
CRO Services
Product recommended

All MAP3K8 Reagents
MAP3K8 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1404 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human mitogen-activated protein kinase kinase kinase 8.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
NheI + XbaI (6.1kb + 1.4kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
MAP3K8 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MAP3K8 cDNA ORF Clone, Human, untagged Validated Images
Human TPL2/MAP3K8/MEKK8 Gene Plasmid Map 7350
MAP3K8 cDNA ORF Clone, Human, untagged Alternative Names
AURA2 cDNA ORF Clone, Human;c-COT cDNA ORF Clone, Human;COT cDNA ORF Clone, Human;EST cDNA ORF Clone, Human;ESTF cDNA ORF Clone, Human;MEKK8 cDNA ORF Clone, Human;Tpl-2 cDNA ORF Clone, Human;TPL2 cDNA ORF Clone, Human
MAP3K8 Background Information

Mitogen-activated protein kinase kinase kinase 8, also known as Cancer Osaka thyroid oncogene, Proto-oncogene c-Cot, Serine/threonine-protein kinase cot, Tumor progression locus 2 and MAP3K8, is a cytoplasm protein which belongs to the protein kinase superfamily, STE Ser/Thr protein kinase family and MAP kinase kinase kinase subfamily. MAP3K8 is expressed in several normal tissues and human tumor-derived cell lines. Isoform 1 of MAP3K8 is activated specifically during the S and G2/M phases of the cell cycle. MAP3K8 is required for TLR4 activation of the MEK/ERK pathway. It is able to activate NF-kappa-B 1 by stimulating proteasome-mediated proteolysis of NF-kappa-B 1/p105. MAP3K8 plays a role in the cell cycle. The longer form has some transforming activity, although it is much weaker than the activated cot oncoprotein. MAP3K8 oncogene linked to human endometrial carcinoma suggesting that it may be another molecule involved in human endometrial cancer. MAP3K8 may also be an important mediator of intracellular mechanotransduction in human bone marrow-derived mesenchymal stem cells (MSCs).

Full Name
mitogen-activated protein kinase kinase kinase 8
References
  • Clark,A.M. et al., 2004, Genes Chromosomes Cancer. 41 (2):99-108.
  • Chan,H. et al., 2005, Biochem Biophys Res Commun. 328 (1):198-205.
  • Aparecida Alves,C. et al., 2006, Eur J Gynaecol Oncol. 27 (6):589-93.
  • Mielke,L.A. et al., 2009, J Immunol. 183 (12):7984-93.
  • Glossop,J.R. et al., 2009,Gene Expr Patterns  9 (5):381-8. 
  • MAP3K8 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    MAP3K8 cDNA ORF Clone in Cloning Vector, Mouse MG50438-M
    MAP3K8 cDNA ORF Clone, Mouse, untagged MG50438-UT
    MAP3K8 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50438-ACGLN
    MAP3K8 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50438-ACG
    MAP3K8 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50438-ANG
    MAP3K8 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50438-ACR
    MAP3K8 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50438-ANR
    MAP3K8 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50438-CF
    MAP3K8 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50438-NF
    MAP3K8 cDNA ORF Clone, Mouse, C-His tag MG50438-CH
    MAP3K8 cDNA ORF Clone, Mouse, N-His tag MG50438-NH
    MAP3K8 cDNA ORF Clone, Mouse, C-HA tag MG50438-CY
    MAP3K8 cDNA ORF Clone, Mouse, N-HA tag MG50438-NY
    MAP3K8 cDNA ORF Clone, Mouse, C-Myc tag MG50438-CM
    MAP3K8 cDNA ORF Clone, Mouse, N-Myc tag MG50438-NM
    MAP3K8 qPCR Primer Pairs, Mouse MP200447

    MAP3K8 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    MAP3K8 cDNA ORF Clone in Cloning Vector, Human HG10800-M
    MAP3K8 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10800-ACGLN
    MAP3K8 cDNA ORF Clone, Human, C-GFPSpark® tag HG10800-ACG
    MAP3K8 cDNA ORF Clone, Human, N-GFPSpark® tag HG10800-ANG
    MAP3K8 cDNA ORF Clone, Human, C-OFPSpark® tag HG10800-ACR
    MAP3K8 cDNA ORF Clone, Human, N-OFPSpark® tag HG10800-ANR
    MAP3K8 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10800-CF
    MAP3K8 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10800-NF
    MAP3K8 cDNA ORF Clone, Human, C-His tag HG10800-CH
    MAP3K8 cDNA ORF Clone, Human, N-His tag HG10800-NH
    MAP3K8 cDNA ORF Clone, Human, C-HA tag HG10800-CY
    MAP3K8 cDNA ORF Clone, Human, N-HA tag HG10800-NY
    MAP3K8 cDNA ORF Clone, Human, C-Myc tag HG10800-CM
    MAP3K8 cDNA ORF Clone, Human, N-Myc tag HG10800-NM
    MAP3K8 qPCR Primer Pairs, Human HP100714
    info info
    添加购物车成功! 添加购物车失败!