MAP3K3/MEKK3 cDNA ORF Clone, Human, C-Myc tag

Cat: HG10709-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MAP3K3/MEKK3 Reagents
CRO Services
Product recommended

All MAP3K3/MEKK3 Reagents
MAP3K3/MEKK3 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1881 bp
Description
Full length Clone DNA of Human mitogen-activated protein kinase kinase kinase 3 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MAP3K3/MEKK3 cDNA ORF Clone, Human, C-Myc tag Alternative Names
MAPKKK3 cDNA ORF Clone, Human;MEKK3 cDNA ORF Clone, Human
MAP3K3/MEKK3 Background Information
Full Name
mitogen-activated protein kinase kinase kinase 3

MAP3K3/MEKK3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MAP3K3/MEKK3 cDNA ORF Clone in Cloning Vector, Mouse MG50858-G
MAP3K3/MEKK3 cDNA ORF Clone, Mouse, untagged MG50858-UT
MAP3K3/MEKK3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50858-ACGLN
MAP3K3/MEKK3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50858-ACG
MAP3K3/MEKK3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50858-ANG
MAP3K3/MEKK3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50858-ACR
MAP3K3/MEKK3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50858-ANR
MAP3K3/MEKK3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50858-CF
MAP3K3/MEKK3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50858-NF
MAP3K3/MEKK3 cDNA ORF Clone, Mouse, C-His tag MG50858-CH
MAP3K3/MEKK3 cDNA ORF Clone, Mouse, N-His tag MG50858-NH
MAP3K3/MEKK3 cDNA ORF Clone, Mouse, C-HA tag MG50858-CY
MAP3K3/MEKK3 cDNA ORF Clone, Mouse, N-HA tag MG50858-NY
MAP3K3/MEKK3 cDNA ORF Clone, Mouse, C-Myc tag MG50858-CM
MAP3K3/MEKK3 cDNA ORF Clone, Mouse, N-Myc tag MG50858-NM
MAP3K3/MEKK3 qPCR Primer Pairs, Mouse MP200829

MAP3K3/MEKK3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MAP3K3/MEKK3 cDNA ORF Clone in Cloning Vector, Human HG10709-M
MAP3K3/MEKK3 cDNA ORF Clone, Human, untagged HG10709-UT
MAP3K3/MEKK3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10709-ACGLN
MAP3K3/MEKK3 cDNA ORF Clone, Human, C-GFPSpark® tag HG10709-ACG
MAP3K3/MEKK3 cDNA ORF Clone, Human, N-GFPSpark® tag HG10709-ANG
MAP3K3/MEKK3 cDNA ORF Clone, Human, C-OFPSpark® tag HG10709-ACR
MAP3K3/MEKK3 cDNA ORF Clone, Human, N-OFPSpark® tag HG10709-ANR
MAP3K3/MEKK3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10709-CF
MAP3K3/MEKK3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10709-NF
MAP3K3/MEKK3 cDNA ORF Clone, Human, C-His tag HG10709-CH
MAP3K3/MEKK3 cDNA ORF Clone, Human, N-His tag HG10709-NH
MAP3K3/MEKK3 cDNA ORF Clone, Human, C-HA tag HG10709-CY
MAP3K3/MEKK3 cDNA ORF Clone, Human, N-HA tag HG10709-NY
MAP3K3/MEKK3 cDNA ORF Clone, Human, N-Myc tag HG10709-NM
MAP3K3/MEKK3 qPCR Primer Pairs, Human HP100653
info info
添加购物车成功! 添加购物车失败!