MAP3K13 cDNA ORF Clone, Human, C-HA tag

Cat: HG10634-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MAP3K13 Reagents
CRO Services
Product recommended

All MAP3K13 Reagents
MAP3K13 cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2901 bp
Description
Full length Clone DNA of Human mitogen-activated protein kinase kinase kinase 13 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MAP3K13 cDNA ORF Clone, Human, C-HA tag Alternative Names
LZK cDNA ORF Clone, Human;MEKK13 cDNA ORF Clone, Human;MLK cDNA ORF Clone, Human
MAP3K13 Background Information
Full Name
mitogen-activated protein kinase kinase kinase 13

MAP3K13 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MAP3K13 cDNA ORF Clone in Cloning Vector, Mouse MG50831-G
MAP3K13 cDNA ORF Clone, Mouse, untagged MG50831-UT
MAP3K13 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50831-ACGLN
MAP3K13 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50831-ACG
MAP3K13 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50831-ANG
MAP3K13 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50831-ACR
MAP3K13 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50831-ANR
MAP3K13 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50831-CF
MAP3K13 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50831-NF
MAP3K13 cDNA ORF Clone, Mouse, C-His tag MG50831-CH
MAP3K13 cDNA ORF Clone, Mouse, N-His tag MG50831-NH
MAP3K13 cDNA ORF Clone, Mouse, C-HA tag MG50831-CY
MAP3K13 cDNA ORF Clone, Mouse, N-HA tag MG50831-NY
MAP3K13 cDNA ORF Clone, Mouse, C-Myc tag MG50831-CM
MAP3K13 cDNA ORF Clone, Mouse, N-Myc tag MG50831-NM
MAP3K13 qPCR Primer Pairs, Mouse MP200802

MAP3K13 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MAP3K13 cDNA ORF Clone in Cloning Vector, Human HG10634-M
MAP3K13 cDNA ORF Clone, Human, untagged HG10634-UT
MAP3K13 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10634-ACGLN
MAP3K13 cDNA ORF Clone, Human, C-GFPSpark® tag HG10634-ACG
MAP3K13 cDNA ORF Clone, Human, N-GFPSpark® tag HG10634-ANG
MAP3K13 cDNA ORF Clone, Human, C-OFPSpark® tag HG10634-ACR
MAP3K13 cDNA ORF Clone, Human, N-OFPSpark® tag HG10634-ANR
MAP3K13 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10634-CF
MAP3K13 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10634-NF
MAP3K13 cDNA ORF Clone, Human, C-His tag HG10634-CH
MAP3K13 cDNA ORF Clone, Human, N-His tag HG10634-NH
MAP3K13 cDNA ORF Clone, Human, N-HA tag HG10634-NY
MAP3K13 cDNA ORF Clone, Human, C-Myc tag HG10634-CM
MAP3K13 cDNA ORF Clone, Human, N-Myc tag HG10634-NM
MAP3K13 qPCR Primer Pairs, Human HP100869
info info
添加购物车成功! 添加购物车失败!