MKK6 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10422-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MKK6 Reagents
CRO Services
Product recommended

All MKK6 Reagents
MKK6 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1005 bp
Description
Full length Clone DNA of Human mitogen-activated protein kinase kinase 6 (MAP2K6) with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MKK6 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
MAPKK6 cDNA ORF Clone, Human;MEK6 cDNA ORF Clone, Human;MKK6 cDNA ORF Clone, Human;PRKMK6 cDNA ORF Clone, Human;SAPKK-3 cDNA ORF Clone, Human;SAPKK3 cDNA ORF Clone, Human
MKK6 Background Information

Dual specificity mitogen-activated protein kinase kinase 6, also known as MAP kinase kinase 6, MAPKK 6, MAPK / ERK kinase 6, SAPKK3, MAP2K6 and MKK6, is a protein which belongs to the?protein kinase superfamily, STE Ser / Thr protein kinase family and MAP kinase kinase subfamily. MAP2K6 / MKK6 contains one?protein kinase domain. Mitogen-activated protein kinases are members of a conserved cascade of kinases involved in many signal transduction pathways. They stimulate phosphorylation of transcription factors in response to extracellular signals such as growth factors, cytokines, ultraviolet light, and stress-inducing agents. MAP2K6 / MKK6 exists in a variety of alternatively spliced isoforms with distinct patterns of tissue expression. Isoform 2 of MAP2K6 / MKK6 is only expressed in skeletal muscle. Isoform 1 of MAP2K6 / MKK6 is expressed in skeletal muscle, heart, and in lesser extent in liver or pancreas.

Full Name
mitogen-activated protein kinase kinase 6
References
  • Raingeaud J., et al.,(1996), MKK3- and MKK6-regulated gene expression is mediated by the p38 mitogen-activated protein kinase signal transduction pathway. Mol. Cell. Biol. 16:1247-1255.
  • Stein B., et al., (1996), Cloning and characterization of MEK6, a novel member of the mitogen-activated protein kinase kinase cascade.J. Biol. Chem. 271:11427-11433.
  • Han J., et al.,(1996), Characterization of the structure and function of a novel MAP kinase kinase (MKK6).J. Biol. Chem. 271:2886-2891.
  • info info
    添加购物车成功! 添加购物车失败!