MEK2 cDNA ORF Clone, Human, C-Myc tag

Cat: HG10678-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MEK2 Reagents
CRO Services
Product recommended

All MEK2 Reagents
MEK2 cDNA ORF Clone, Human, C-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1203 bp
Description
Full length Clone DNA of Human mitogen-activated protein kinase kinase 2 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MEK2 cDNA ORF Clone, Human, C-Myc tag Alternative Names
CFC4 cDNA ORF Clone, Human;FLJ26075 cDNA ORF Clone, Human;MAPKK2 cDNA ORF Clone, Human;MEK2 cDNA ORF Clone, Human;MKK2 cDNA ORF Clone, Human;PRKMK2 cDNA ORF Clone, Human
MEK2 Background Information

Dual specificity mitogen-activated protein kinase kinase 2, also known as MAP kinase kinase 2, MAPKK2, ERK activator kinase 2, MAPK / ERK kinase 2, MEK2 and MAP2K2, is a member of the protein kinase superfamily, STE Ser/Thr protein kinase family and MAP kinase kinase subfamily. MAP2K2 / MEK2 contains one protein kinase domain. MEK1 and MEK2 (also known as MAP2K1 and MAP2K2, respectively) are evolutionarily conserved, dual-specificity kinases that mediate Erk1 and Erk2 activation during adhesion and growth factor signaling. MAP2K1 / MEK1 is a crucial modulator of Mek and Erk signaling and have potential implications for the role of MEK1 and MEK2 in tumorigenesis. MAP2K2 / MEK2 catalyzes the concomitant phosphorylation of a threonine and a tyrosine residue in a Thr-Glu-Tyr sequence located in MAP kinases. It also activates the ERK1 and ERK2 MAP kinases. Defects in MAP2K2 are a cause of cardiofaciocutaneous syndrome (CFC syndrome) which is characterized by a distinctive facial appearance, heart defects and mental retardation. Heart defects include pulmonic stenosis, atrial septal defects and hypertrophic cardiomyopathy.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
mitogen-activated protein kinase kinase 2
References
  • MacDonald,T.J. et al., 2001, Nat Genet. 29 (2):143-52.
  • Mittal R., et al., 2006, Proc. Natl. Acad. Sci. USA. 103:18574-9.
  • Narumi,Y. et al., 2007, Am J Med Genet A. 143A (8):799-807.
  • Daub H., et al., 2008, Mol. Cell 31:438-448.
  • Catalanotti,F. et al., 2009, Nat Struct Mol Biol. 16 (3):294-303.
  • MEK2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    MEK2 cDNA ORF Clone in Cloning Vector, Mouse MG50338-G
    MEK2 cDNA ORF Clone, Mouse, untagged MG50338-UT
    MEK2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50338-ACG
    MEK2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50338-ACGLN
    MEK2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50338-ANG
    MEK2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50338-ACR
    MEK2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50338-ANR
    MEK2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50338-CF
    MEK2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50338-NF
    MEK2 cDNA ORF Clone, Mouse, C-His tag MG50338-CH
    MEK2 cDNA ORF Clone, Mouse, N-His tag MG50338-NH
    MEK2 cDNA ORF Clone, Mouse, C-HA tag MG50338-CY
    MEK2 cDNA ORF Clone, Mouse, N-HA tag MG50338-NY
    MEK2 cDNA ORF Clone, Mouse, C-Myc tag MG50338-CM
    MEK2 cDNA ORF Clone, Mouse, N-Myc tag MG50338-NM
    MEK2 qPCR Primer Pairs, Mouse MP200361

    MEK2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    MEK2 cDNA ORF Clone in Cloning Vector, Human HG10678-M
    MEK2 cDNA ORF Clone, Human, untagged HG10678-UT
    MEK2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10678-ACG
    MEK2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10678-ACGLN
    MEK2 cDNA ORF Clone, Human, N-GFPSpark® tag HG10678-ANG
    MEK2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10678-ACR
    MEK2 cDNA ORF Clone, Human, N-OFPSpark® tag HG10678-ANR
    MEK2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10678-CF
    MEK2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10678-NF
    MEK2 cDNA ORF Clone, Human, C-His tag HG10678-CH
    MEK2 cDNA ORF Clone, Human, N-His tag HG10678-NH
    MEK2 cDNA ORF Clone, Human, C-HA tag HG10678-CY
    MEK2 cDNA ORF Clone, Human, N-HA tag HG10678-NY
    MEK2 cDNA ORF Clone, Human, N-Myc tag HG10678-NM
    MEK2 qPCR Primer Pairs, Human HP100643
    info info
    添加购物车成功! 添加购物车失败!