After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human MAP2K2 natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human MAP2K2 cDNA Clone Product Information
NCBI RefSeq:NM_030662.3
RefSeq ORF Size:1203bp
cDNA Description:Full length Clone DNA of Homo sapiens mitogen-activated protein kinase kinase 2.
Gene Synonym:MEK2, MKK2, MAPKK2, PRKMK2, FLJ26075, MAP2K2
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Dual specificity mitogen-activated protein kinase kinase 2, also known as MAP kinase kinase 2, MAPKK2, ERK activator kinase 2, MAPK / ERK kinase 2, MEK2 and MAP2K2, is a member of the protein kinase superfamily, STE Ser/Thr protein kinase family and MAP kinase kinase subfamily. MAP2K2 / MEK2 contains one protein kinase domain. MEK1 and MEK2 (also known as MAP2K1 and MAP2K2, respectively) are evolutionarily conserved, dual-specificity kinases that mediate Erk1 and Erk2 activation during adhesion and growth factor signaling. MAP2K1 / MEK1 is a crucial modulator of Mek and Erk signaling and have potential implications for the role of MEK1 and MEK2 in tumorigenesis. MAP2K2 / MEK2 catalyzes the concomitant phosphorylation of a threonine and a tyrosine residue in a Thr-Glu-Tyr sequence located in MAP kinases. It also activates the ERK1 and ERK2 MAP kinases. Defects in MAP2K2 are a cause of cardiofaciocutaneous syndrome (CFC syndrome) which is characterized by a distinctive facial appearance, heart defects and mental retardation. Heart defects include pulmonic stenosis, atrial septal defects and hypertrophic cardiomyopathy.

References
  • MacDonald,T.J. et al., 2001, Nat Genet. 29 (2):143-52.
  • Mittal R., et al., 2006, Proc. Natl. Acad. Sci. USA. 103:18574-9.
  • Narumi,Y. et al., 2007, Am J Med Genet A. 143A (8):799-807.
  • Daub H., et al., 2008, Mol. Cell 31:438-448.
  • Catalanotti,F. et al., 2009, Nat Struct Mol Biol. 16 (3):294-303.
  • Size / Price
    Catalog: HG10678-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"