Quick Order

Text Size:AAA

Human LC3A/MAP1LC3A Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Human MAP1LC3A cDNA Clone Product Information
NCBI RefSeq:BC015810
RefSeq ORF Size:366bp
cDNA Description:Full length Clone DNA of Homo sapiens microtubule-associated protein 1 light chain 3 alpha with N terminal His tag.
Gene Synonym:RP11-346K17.1, ATG8E, LC3, LC3A, MAP1ALC3, MAP1BLC3, MAP1LC3A
Species:Human
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

LC3A, also known as MAP1LC3A, is one of the light chain subunits that functions together with both MAP1A and/or MAP1B. MAP1A and MAP1B are microtubule-associated proteins which mediate the physical interactions between microtubules and components of the cytoskeleton. MAP1A and MAP1B each consist of a heavy chain subunit and multiple light chain subunits. As a light chain subunit, MAP1LC3A has an important part in neuronal development and in maintaining the balance between neuronal plasticity and rigidity. MAP1LC3A is expressed as two alternatively spliced isoforms that are expressed in testis, brain, heart, liver and skeletal muscle, but are absent in thymus and peripheral blood leukocytes.

Size / Price
Catalog: HG14322-NH
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"