After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human MAOA natural ORF mammalian expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human MAOA cDNA Clone Product Information
NCBI RefSeq:NM_000240
RefSeq ORF Size:1584bp
cDNA Description:Full length Clone DNA of Homo sapiens monoamine oxidase A.
Gene Synonym:MAOA
Species:Human
Vector:pCMV3-untagged
Plasmid:pCMV3-MAOA
Restriction Site:KpnI + XbaI (6.1kb + 1.58kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human MAOA Gene Plasmid Map
Human MAOA Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
References
  • Huang SY, et al. (2009) Association of monoamine oxidase A (MAOA) polymorphisms and clinical subgroups of major depressive disorders in the Han Chinese population. World J Biol Psychiatry. 10 (4): 544-51.
  • Guo G, et al. (2008) The VNTR 2 repeat in MAOA and delinquent behavior in adolescence and young adulthood: associations and MAOA promoter activity. Eur J Hum Genet. 16(5): 626-34
  • McDermott R, et al. (2009) Monoamine oxidase A gene (MAOA) predicts behavioral aggression following provocation. Proc Natl Acad Sci. 106 (7): 2118-23.
  • Size / Price
    Catalog: HG12051-UT
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    Images
    • Human MAOA Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"