ARMET cDNA ORF Clone, Human, N-HA tag

Cat: HG11324-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ARMET Reagents
CRO Services
Product recommended

All ARMET Reagents
ARMET cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
558 bp
Description
Full length Clone DNA of Human mesencephalic astrocyte-derived neurotrophic factor with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ARMET cDNA ORF Clone, Human, N-HA tag Alternative Names
ARMET cDNA ORF Clone, Human;ARP cDNA ORF Clone, Human
ARMET Background Information

Mesencephalic astrocyte-derived neurotrophic factor, also known as Protein ARMET, Arginine-rich protein, MANF and ARMET, is a secreted protein which belongs to the ARMET family. ARMET selectively promotes the survival of dopaminergic neurons of the ventral mid-brain. It modulates GABAergic transmission to the dopaminergic neurons of the substantia nigra. ARMET enhances spontaneous, as well as evoked, GABAergic inhibitory postsynaptic currents in dopaminergic neurons. ARMET inhibits cell proliferation and endoplasmic reticulum (ER) stress-induced cell death. The N-terminal region of ARMET may be responsible for neurotrophic activity while the C-terminal region may play a role in the ER stress response. MANF reduces endoplasmic reticulum (ER) stress and has neurotrophic effects on dopaminergic neurons. Intracortical delivery of recombinant MANF protein protects tissue from ischemic brain injury. MANF has been described as a survival factor for dopaminergic neurons. MANF expression was widespread in the nervous system and non-neuronal tissues. In the brain, relatively high MANF levels were detected in the cerebral cortex, hippocampus and cerebellar Purkinje cells. The widespread expression of MANF together with its evolutionary conserved nature and regulation by brain insults suggest that it has important functions both under normal and pathological conditions in many tissue types.

Full Name
mesencephalic astrocyte-derived neurotrophic factor
References
  • Shridhar V., et al., 1996, Oncogene 12:1931-1939.
  • Gevaert K., et al., 2003, Nat. Biotechnol. 21:566-569.
  • Petrova P., et al., 2003, J. Mol. Neurosci. 20:173-188.
  • Lindholm, P. et al., 2008, Mol Cell Neurosci. 39 (3):356-71.
  • Airavaara, M. et al., 2010, Exp Neurol. 225 (1):104-13.
  • ARMET cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    ARMET cDNA ORF Clone in Cloning Vector, Rat RG83598-U
    ARMET Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG83598-ACGLN

    ARMET cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    ARMET cDNA ORF Clone in Cloning Vector, Mouse MG50954-G
    ARMET cDNA ORF Clone, Mouse, untagged MG50954-UT
    ARMET Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50954-ACGLN
    ARMET cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50954-ACG
    ARMET cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50954-ACR
    ARMET cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50954-CF
    ARMET cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50954-NF
    ARMET cDNA ORF Clone, Mouse, C-His tag MG50954-CH
    ARMET cDNA ORF Clone, Mouse, N-His tag MG50954-NH
    ARMET cDNA ORF Clone, Mouse, C-HA tag MG50954-CY
    ARMET cDNA ORF Clone, Mouse, N-HA tag MG50954-NY
    ARMET cDNA ORF Clone, Mouse, C-Myc tag MG50954-CM
    ARMET cDNA ORF Clone, Mouse, N-Myc tag MG50954-NM
    ARMET qPCR Primer Pairs, Mouse MP200923

    ARMET cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ARMET cDNA ORF Clone in Cloning Vector, Human HG11324-M
    ARMET cDNA ORF Clone, Human, untagged HG11324-UT
    ARMET cDNA ORF Clone, Human, C-GFPSpark® tag HG11324-ACG
    ARMET Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11324-ACGLN
    ARMET cDNA ORF Clone, Human, C-OFPSpark® tag HG11324-ACR
    ARMET cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11324-CF
    ARMET cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11324-NF
    ARMET cDNA ORF Clone, Human, C-His tag HG11324-CH
    ARMET cDNA ORF Clone, Human, N-His tag HG11324-NH
    ARMET cDNA ORF Clone, Human, C-HA tag HG11324-CY
    ARMET cDNA ORF Clone, Human, C-Myc tag HG11324-CM
    ARMET cDNA ORF Clone, Human, N-Myc tag HG11324-NM
    ARMET qPCR Primer Pairs, Human HP101209
    info info
    添加购物车成功! 添加购物车失败!