MAF1 cDNA ORF Clone, Human, C-His tag

Cat: HG14684-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MAF1 Reagents
CRO Services
Product recommended

All MAF1 Reagents
MAF1 cDNA ORF Clone, Human, C-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
771 bp
Description
Full length Clone DNA of Human MAF1 homolog (S. cerevisiae) with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MAF1 Background Information
Full Name
MAF1 homolog (S. cerevisiae)

MAF1 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
MAF1 cDNA ORF Clone in Cloning Vector, Rhesus CG90668-G
MAF1 cDNA ORF Clone, Rhesus, untagged CG90668-UT
MAF1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90668-ACG
MAF1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90668-ACGLN
MAF1 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90668-ANG
MAF1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90668-ACR
MAF1 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90668-ANR
MAF1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90668-CF
MAF1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90668-NF
MAF1 cDNA ORF Clone, Rhesus, C-His tag CG90668-CH
MAF1 cDNA ORF Clone, Rhesus, N-His tag CG90668-NH
MAF1 cDNA ORF Clone, Rhesus, C-HA tag CG90668-CY
MAF1 cDNA ORF Clone, Rhesus, N-HA tag CG90668-NY
MAF1 cDNA ORF Clone, Rhesus, C-Myc tag CG90668-CM
MAF1 cDNA ORF Clone, Rhesus, N-Myc tag CG90668-NM

MAF1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MAF1 cDNA ORF Clone in Cloning Vector, Mouse MG51918-G
MAF1 cDNA ORF Clone, Mouse, untagged MG51918-UT
MAF1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51918-ACGLN
MAF1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51918-ACG
MAF1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51918-ANG
MAF1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51918-ACR
MAF1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51918-ANR
MAF1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51918-CF
MAF1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51918-NF
MAF1 cDNA ORF Clone, Mouse, C-His tag MG51918-CH
MAF1 cDNA ORF Clone, Mouse, N-His tag MG51918-NH
MAF1 cDNA ORF Clone, Mouse, C-HA tag MG51918-CY
MAF1 cDNA ORF Clone, Mouse, N-HA tag MG51918-NY
MAF1 cDNA ORF Clone, Mouse, C-Myc tag MG51918-CM
MAF1 cDNA ORF Clone, Mouse, N-Myc tag MG51918-NM
MAF1 qPCR Primer Pairs, Mouse MP201791

MAF1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MAF1 cDNA ORF Clone in Cloning Vector, Human HG14684-G
MAF1 cDNA ORF Clone, Human, untagged HG14684-UT
MAF1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14684-ACGLN
MAF1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14684-ACG
MAF1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14684-ANG
MAF1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14684-ACR
MAF1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14684-ANR
MAF1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14684-CF
MAF1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14684-NF
MAF1 cDNA ORF Clone, Human, N-His tag HG14684-NH
MAF1 cDNA ORF Clone, Human, C-HA tag HG14684-CY
MAF1 cDNA ORF Clone, Human, N-HA tag HG14684-NY
MAF1 cDNA ORF Clone, Human, C-Myc tag HG14684-CM
MAF1 cDNA ORF Clone, Human, N-Myc tag HG14684-NM
MAF1 qPCR Primer Pairs, Human HP103318
info info
添加购物车成功! 添加购物车失败!