MAEA cDNA ORF Clone, Human, N-HA tag

Cat: HG14116-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MAEA Reagents
CRO Services
Product recommended

All MAEA Reagents
MAEA cDNA ORF Clone, Human, N-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1191 bp
Description
Full length Clone DNA of Human macrophage erythroblast attacher with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MAEA cDNA ORF Clone, Human, N-HA tag Alternative Names
EMLP cDNA ORF Clone, Human;EMP cDNA ORF Clone, Human;GID9 cDNA ORF Clone, Human;HLC-10 cDNA ORF Clone, Human;PIG5 cDNA ORF Clone, Human
MAEA Background Information
Full Name
macrophage erythroblast attacher

MAEA cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MAEA cDNA ORF Clone in Cloning Vector, Rat RG8A1577-U
MAEA Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A1577-ACGLN

MAEA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MAEA cDNA ORF Clone in Cloning Vector, Mouse MG52755-G
MAEA cDNA ORF Clone, Mouse, untagged MG52755-UT
MAEA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52755-ACG
MAEA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52755-ACGLN
MAEA cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52755-ANG
MAEA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52755-ACR
MAEA cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52755-ANR
MAEA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52755-CF
MAEA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52755-NF
MAEA cDNA ORF Clone, Mouse, C-His tag MG52755-CH
MAEA cDNA ORF Clone, Mouse, N-His tag MG52755-NH
MAEA cDNA ORF Clone, Mouse, C-HA tag MG52755-CY
MAEA cDNA ORF Clone, Mouse, N-HA tag MG52755-NY
MAEA cDNA ORF Clone, Mouse, C-Myc tag MG52755-CM
MAEA cDNA ORF Clone, Mouse, N-Myc tag MG52755-NM

MAEA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MAEA cDNA ORF Clone in Cloning Vector, Human HG14116-G
MAEA cDNA ORF Clone, Human, untagged HG14116-UT
MAEA cDNA ORF Clone, Human, C-GFPSpark® tag HG14116-ACG
MAEA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14116-ACGLN
MAEA cDNA ORF Clone, Human, N-GFPSpark® tag HG14116-ANG
MAEA cDNA ORF Clone, Human, C-OFPSpark® tag HG14116-ACR
MAEA cDNA ORF Clone, Human, N-OFPSpark® tag HG14116-ANR
MAEA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14116-CF
MAEA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14116-NF
MAEA cDNA ORF Clone, Human, C-His tag HG14116-CH
MAEA cDNA ORF Clone, Human, N-His tag HG14116-NH
MAEA cDNA ORF Clone, Human, C-HA tag HG14116-CY
MAEA cDNA ORF Clone, Human, C-Myc tag HG14116-CM
MAEA cDNA ORF Clone, Human, N-Myc tag HG14116-NM
MAEA qPCR Primer Pairs, Human HP102769
info info
添加购物车成功! 添加购物车失败!