MAD2L1BP cDNA ORF Clone, Human, C-HA tag

Cat: HG14700-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MAD2L1BP Reagents
CRO Services
Product recommended

All MAD2L1BP Reagents
MAD2L1BP cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
825 bp
Description
Full length Clone DNA of Human MAD2L1 binding protein with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MAD2L1BP cDNA ORF Clone, Human, C-HA tag Alternative Names
CMT2 cDNA ORF Clone, Human
MAD2L1BP Background Information
Full Name
MAD2L1 binding protein

MAD2L1BP cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MAD2L1BP cDNA ORF Clone in Cloning Vector, Rat RG8A1045-U
MAD2L1BP Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A1045-ACGLN

MAD2L1BP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MAD2L1BP cDNA ORF Clone in Cloning Vector, Mouse MG5A4719-U
MAD2L1BP cDNA ORF Clone, Mouse, untagged MG5A4719-UT
MAD2L1BP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4719-ACG
MAD2L1BP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A4719-ACGLN
MAD2L1BP cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A4719-ANG
MAD2L1BP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A4719-ACR
MAD2L1BP cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A4719-ANR
MAD2L1BP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A4719-CF
MAD2L1BP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A4719-NF
MAD2L1BP cDNA ORF Clone, Mouse, C-His tag MG5A4719-CH
MAD2L1BP cDNA ORF Clone, Mouse, N-His tag MG5A4719-NH
MAD2L1BP cDNA ORF Clone, Mouse, C-HA tag MG5A4719-CY
MAD2L1BP cDNA ORF Clone, Mouse, N-HA tag MG5A4719-NY
MAD2L1BP cDNA ORF Clone, Mouse, C-Myc tag MG5A4719-CM
MAD2L1BP cDNA ORF Clone, Mouse, N-Myc tag MG5A4719-NM

MAD2L1BP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MAD2L1BP cDNA ORF Clone in Cloning Vector, Human HG14700-G
MAD2L1BP cDNA ORF Clone, Human, untagged HG14700-UT
MAD2L1BP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14700-ACGLN
MAD2L1BP cDNA ORF Clone, Human, C-GFPSpark® tag HG14700-ACG
MAD2L1BP cDNA ORF Clone, Human, N-GFPSpark® tag HG14700-ANG
MAD2L1BP cDNA ORF Clone, Human, C-OFPSpark® tag HG14700-ACR
MAD2L1BP cDNA ORF Clone, Human, N-OFPSpark® tag HG14700-ANR
MAD2L1BP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14700-CF
MAD2L1BP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14700-NF
MAD2L1BP cDNA ORF Clone, Human, C-His tag HG14700-CH
MAD2L1BP cDNA ORF Clone, Human, N-His tag HG14700-NH
MAD2L1BP cDNA ORF Clone, Human, N-HA tag HG14700-NY
MAD2L1BP cDNA ORF Clone, Human, C-Myc tag HG14700-CM
MAD2L1BP cDNA ORF Clone, Human, N-Myc tag HG14700-NM
MAD2L1BP qPCR Primer Pairs, Human HP103334
info info
添加购物车成功! 添加购物车失败!