M6PR cDNA ORF Clone, Human, C-HA tag

Cat: HG14087-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All M6PR Reagents
CRO Services
Product recommended

All M6PR Reagents
M6PR cDNA ORF Clone, Human, C-HA tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
834 bp
Description
Full length Clone DNA of Human mannose-6-phosphate receptor (cation dependent) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

M6PR cDNA ORF Clone, Human, C-HA tag Alternative Names
CD-MPR cDNA ORF Clone, Human;MPR-46 cDNA ORF Clone, Human;MPR46 cDNA ORF Clone, Human;SMPR cDNA ORF Clone, Human
M6PR Background Information
Full Name
mannose-6-phosphate receptor (cation dependent)

M6PR cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
M6PR cDNA ORF Clone in Cloning Vector, Mouse MG51944-U
M6PR cDNA ORF Clone, Mouse, untagged MG51944-UT
M6PR cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51944-ACG
M6PR Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51944-ACGLN
M6PR cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51944-ACR
M6PR cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51944-CF
M6PR cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51944-NF
M6PR cDNA ORF Clone, Mouse, C-His tag MG51944-CH
M6PR cDNA ORF Clone, Mouse, N-His tag MG51944-NH
M6PR cDNA ORF Clone, Mouse, C-HA tag MG51944-CY
M6PR cDNA ORF Clone, Mouse, N-HA tag MG51944-NY
M6PR cDNA ORF Clone, Mouse, C-Myc tag MG51944-CM
M6PR cDNA ORF Clone, Mouse, N-Myc tag MG51944-NM
M6PR qPCR Primer Pairs, Mouse MP201817

M6PR cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
M6PR cDNA ORF Clone in Cloning Vector, Human HG14087-G
M6PR cDNA ORF Clone, Human, untagged HG14087-UT
M6PR Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14087-ACGLN
M6PR cDNA ORF Clone, Human, C-GFPSpark® tag HG14087-ACG
M6PR cDNA ORF Clone, Human, C-OFPSpark® tag HG14087-ACR
M6PR cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14087-CF
M6PR cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14087-NF
M6PR cDNA ORF Clone, Human, C-His tag HG14087-CH
M6PR cDNA ORF Clone, Human, N-His tag HG14087-NH
M6PR cDNA ORF Clone, Human, N-HA tag HG14087-NY
M6PR cDNA ORF Clone, Human, C-Myc tag HG14087-CM
M6PR cDNA ORF Clone, Human, N-Myc tag HG14087-NM
M6PR qPCR Primer Pairs, Human HP102740
info info
添加购物车成功! 添加购物车失败!