Lyn cDNA ORF Clone, Human, N-His tag

Cat: HG10829-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Lyn Reagents
CRO Services
Product recommended

All Lyn Reagents
Lyn cDNA ORF Clone, Human, N-His tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1476 bp
Description
Full length Clone DNA of Human v-yes-1 Yamaguchi sarcoma viral related oncogene homolog , transcript variant 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Lyn cDNA ORF Clone, Human, N-His tag Alternative Names
JTK8 cDNA ORF Clone, Human;p53Lyn cDNA ORF Clone, Human;p56Lyn cDNA ORF Clone, Human
Lyn Background Information

Tyrosine-protein kinase Lyn is a member of the Src family of protein tyrosine kinases, which is mainly expressed in hematopoietic cells, in neural tissues liver, and adipose tissue. Tyrosine-protein kinase Lyn has many functions. Lyn kinase may down regulate expression of stem cell growth factor receptor (KIT). Lyn kinase Acts as an effector of EpoR (erythropoietin receptor) in controlling KIT expression and may play a central role in erythroid differentiation during the switch between proliferation and maturation. Lyn kinase also acts as a positive regulator of cell movement while negatively regulating adhesion to stromal cells by inhibiting the ICAM-1-binding activity of beta-2 integrins. Lyn kinase relays suppressing signals from the chemokine receptor CXCR4 to beta-2 integrin LFA-1 in hematopoietic precursors. This kinase is Involved in induction of stress-activated protein kinase (SAPK), but not ERK or p38 MAPK, in response to genotoxic agents. In a word, Lyn kinase functions primarily as negative regulator, but can also function as activator, depending on the context. Tyrosine-protein kinase Lyn Required for the initiation of the B-cell response, but also for its down-regulation and termination. It also Plays an important role in the regulation of B-cell differentiation, proliferation, survival and apoptosis, and is important for immune self-tolerance. It has been reported that Lyn kinase plays a role in the inflammatory response to bacterial lipopolysaccharide. Lyn kinase Mediates the responses to cytokines and growth factors in hematopoietic progenitors, platelets, erythrocytes, and in mature myeloid cells, such as dendritic cells, neutrophils and eosinophils.

Full Name
LYN proto-oncogene, Src family tyrosine kinase
References
  • Grishin A V, et al. (2001) Interaction between growth arrest-DNA damage protein 34 and Src kinase Lyn negatively regulates genotoxic apoptosis. Proc Natl Acad Sci U.S.A. 98 (18): 10172-7.
  • Hayashi T, et al. (1999) The AMPA receptor interacts with and signals through the protein tyrosine kinase Lyn. Nature. 397(6714): 72-6.
  • Ptasznik A, et al. (2004) Short interfering RNA (siRNA) targeting the Lyn kinase induces apoptosis in primary, and drug-resistant, BCR-ABL1(+) leukemia cells. Nat Med. 10(11): 1187-9.
  • info info
    添加购物车成功! 添加购物车失败!