Latexin cDNA ORF Clone, Human, N-Myc tag

Cat: HG10211-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Latexin Reagents
CRO Services
Product recommended

All Latexin Reagents
Latexin cDNA ORF Clone, Human, N-Myc tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
669 bp
Description
Full length Clone DNA of Human latexin with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Latexin cDNA ORF Clone, Human, N-Myc tag Alternative Names
ECI cDNA ORF Clone, Human;TCI cDNA ORF Clone, Human
Latexin Background Information

Latexin, also known as endogenous carboxypeptidase inhibitor, tissue carboxypeptidase inhibitor, TCI, ECI and LXN, is a cytoplasm protein which belongs to the protease inhibitor I47 (latexin) family. It is highly expressed in heart, prostate, ovary, kidney, pancreas, and colon. Latexin / LXN is the only known endogenous specific inhibitor of zinc-dependent metallocarboxypeptidases (MCPs) present in mammalians so far. Latexin is originally identified as a molecular marker for the regional specification of the neocortex in development in rats. The 222 amino acid latexin in human shows different expression distribution with high levels in heart, prostate, ovary, kidney, pancreas, and colon, but only moderate or low levels in other tissues including brain. Latexin is also expressed at high levels and is inducible in macrophages in concert with other protease inhibitors and potential protease targets, and thus is suggested to play a role in inflammation and innate immunity pathways. Despite of the non-detectable sequence similarity with plant and parasite inhibitors, Latexin is related to a human putative tumor suppressor protein, TIG1. In addition, Latexin is also implicated in Alzheimer's disease.

Full Name
latexin
References
  • Liu Q., et al.,(2000), Cloning, tissue expression pattern and genomic organization of latexin, a human homologue of rat carboxypeptidase A inhibitor. Mol. Biol. Rep. 27:241-246.
  • Gauci S., et al., (2009), Lys-N and trypsin cover complementary parts of the phosphoproteome in a refined SCX-based approach.nal. Chem. 81:4493-4501.
  • Muzny D.M., et al.,(2006), The DNA sequence, annotation and analysis of human chromosome 3.Nature 440:1194-1198.
  • Latexin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Latexin cDNA ORF Clone in Cloning Vector, Mouse MG50050-M
    Latexin cDNA ORF Clone, Mouse, untagged MG50050-UT
    Latexin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50050-ACGLN
    Latexin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50050-ACG
    Latexin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50050-ANG
    Latexin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50050-ACR
    Latexin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50050-ANR
    Latexin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50050-CF
    Latexin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50050-NF
    Latexin cDNA ORF Clone, Mouse, C-His tag MG50050-CH
    Latexin cDNA ORF Clone, Mouse, N-His tag MG50050-NH
    Latexin cDNA ORF Clone, Mouse, C-HA tag MG50050-CY
    Latexin cDNA ORF Clone, Mouse, N-HA tag MG50050-NY
    Latexin cDNA ORF Clone, Mouse, C-Myc tag MG50050-CM
    Latexin cDNA ORF Clone, Mouse, N-Myc tag MG50050-NM
    Latexin qPCR Primer Pairs, Mouse MP200050

    Latexin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Latexin cDNA ORF Clone in Cloning Vector, Human HG10211-M
    Latexin cDNA ORF Clone, Human, untagged HG10211-UT
    Latexin cDNA ORF Clone, Human, C-GFPSpark® tag HG10211-ACG
    Latexin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10211-ACGLN
    Latexin cDNA ORF Clone, Human, N-GFPSpark® tag HG10211-ANG
    Latexin cDNA ORF Clone, Human, C-OFPSpark® tag HG10211-ACR
    Latexin cDNA ORF Clone, Human, N-OFPSpark® tag HG10211-ANR
    Latexin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10211-CF
    Latexin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10211-NF
    Latexin cDNA ORF Clone, Human, C-His tag HG10211-CH
    Latexin cDNA ORF Clone, Human, N-His tag HG10211-NH
    Latexin cDNA ORF Clone, Human, C-HA tag HG10211-CY
    Latexin cDNA ORF Clone, Human, N-HA tag HG10211-NY
    Latexin cDNA ORF Clone, Human, C-Myc tag HG10211-CM
    Latexin qPCR Primer Pairs, Human HP100069
    info info
    添加购物车成功! 添加购物车失败!