Quick Order

Human Latexin Gene ORF cDNA clone expression plasmid, N-His tag

    DatasheetReviewsRelated ProductsProtocols
    Human LXN cDNA Clone Product Information
    NCBI RefSeq:NM_020169.3
    RefSeq ORF Size:669bp
    cDNA Description:Full length Clone DNA of Homo sapiens latexin with N terminal His tag.
    Gene Synonym:LXN, ECI, TCI
    Species:Human
    Vector:pCMV3-N-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with LXN qPCR primers for gene expression analysis, HP100069 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    Background

    Latexin, also known as endogenous carboxypeptidase inhibitor, tissue carboxypeptidase inhibitor, TCI, ECI and LXN, is a cytoplasm protein which belongs to the protease inhibitor I47 (latexin) family. It is highly expressed in heart, prostate, ovary, kidney, pancreas, and colon. Latexin / LXN is the only known endogenous specific inhibitor of zinc-dependent metallocarboxypeptidases (MCPs) present in mammalians so far. Latexin is originally identified as a molecular marker for the regional specification of the neocortex in development in rats. The 222 amino acid latexin in human shows different expression distribution with high levels in heart, prostate, ovary, kidney, pancreas, and colon, but only moderate or low levels in other tissues including brain. Latexin is also expressed at high levels and is inducible in macrophages in concert with other protease inhibitors and potential protease targets, and thus is suggested to play a role in inflammation and innate immunity pathways. Despite of the non-detectable sequence similarity with plant and parasite inhibitors, Latexin is related to a human putative tumor suppressor protein, TIG1. In addition, Latexin is also implicated in Alzheimer's disease.

    Size / Price
    Catalog: HG10211-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"