Quick Order

Text Size:AAA

Human LYRM1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human LYRM1 cDNA Clone Product Information
NCBI RefSeq:BC017039
RefSeq ORF Size:369bp
cDNA Description:Full length Clone DNA of Homo sapiens LYR motif containing 1.
Gene Synonym:A211C6.1, LYRM1
Species:Human
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with LYRM1 qPCR primers for gene expression analysis, HP102973 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Catalog: HG14323-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability
Add to CartBulk Discount Inquiry
Contact Us
Images
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"