LYG1 cDNA ORF Clone, Human, N-DDK (Flag®) tag

Cat: HG13457-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All LYG1 Reagents
CRO Services
Product recommended

All LYG1 Reagents
LYG1 cDNA ORF Clone, Human, N-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
615 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human lysozyme G-like 1 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Restriction Sites
KpnI + XbaI(6kb+0.62kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
LYG1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LYG1 cDNA ORF Clone, Human, N-DDK (Flag®) tag Validated Images
Rhesus CD64/Fc gamma RI Gene Plasmid Map 5614
LYG1 cDNA ORF Clone, Human, N-DDK (Flag®) tag Alternative Names
SALW1939 cDNA ORF Clone, Human
LYG1 Background Information

Lysozyme G-like 1 belongs to the glycosyl hydrolase 23 family. Glycoside hydrolases are a widespread group of enzymes that hydrolyse the glycosidic bond between two or more carbohydrates, or between a carbohydrate and a non-carbohydrate moiety. Lysozyme G-like 1 exhibits hydrolase activity, acting on glycosyl bonds (inferred); lysozyme activity (inferred). It is found in extracellular region and may functions in cell wall macromolecule catabolic process, metabolic process and peptidoglycan catabolic process. The lysozyme G gene structure has been largely conserved during vertebrate evolution, except at the 5' end of the gene, which varies in number of exons.

Full Name
lysozyme G-like 1
References
  • EIrwin DM, et al. (2003) Molecular evolution of vertebrate goose-type lysozyme genes. J Mol Evol. 56(2):234-42.
  • Gerhard DS, et al. (2004) The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 14(10B):2121-7.
  • Sklar P, et al. (2011) Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. Nat Genet. 43(10):977-83.
  • info info
    添加购物车成功! 添加购物车失败!